Incidental Mutation 'R7534:Slc12a7'
ID 628206
Institutional Source Beutler Lab
Gene Symbol Slc12a7
Ensembl Gene ENSMUSG00000017756
Gene Name solute carrier family 12, member 7
Synonyms Kcc4
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7534 (G1)
Quality Score 87.0076
Status Validated
Chromosome 13
Chromosomal Location 73733094-73816754 bp(+) (GRCm38)
Type of Mutation intron
DNA Base Change (assembly) A to G at 73764068 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000017900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017900] [ENSMUST00000220535]
AlphaFold Q9WVL3
Predicted Effect probably benign
Transcript: ENSMUST00000017900
SMART Domains Protein: ENSMUSP00000017900
Gene: ENSMUSG00000017756

DomainStartEndE-ValueType
low complexity region 11 27 N/A INTRINSIC
low complexity region 99 113 N/A INTRINSIC
Pfam:AA_permease 123 308 1e-22 PFAM
low complexity region 390 407 N/A INTRINSIC
Pfam:AA_permease 410 696 1.5e-40 PFAM
Pfam:SLC12 708 834 4.6e-18 PFAM
Pfam:SLC12 818 1083 2.3e-32 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000220535
AA Change: E101G
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (48/48)
MGI Phenotype PHENOTYPE: Hearing is severely impaired in homozygous mutant mice, which also exhibit renal tubular acidosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik G A 1: 105,741,023 R993Q probably benign Het
Aif1 A C 17: 35,171,414 M120R possibly damaging Het
Ank2 T C 3: 126,934,333 probably null Het
Ankrd11 A T 8: 122,894,410 I901N probably damaging Het
Apc T C 18: 34,316,962 S2304P probably damaging Het
AW551984 A T 9: 39,591,481 C632S probably benign Het
Bicra T C 7: 15,971,935 N1527S probably damaging Het
Cacna1d A G 14: 30,079,362 L1363P probably damaging Het
Cacna1g G A 11: 94,411,078 P2037S probably benign Het
Cdc27 A G 11: 104,508,414 L724S probably damaging Het
Cttnbp2 C T 6: 18,420,765 probably null Het
Dchs1 G A 7: 105,772,373 A280V probably benign Het
Dclk3 G A 9: 111,468,218 G277R probably benign Het
Ddr1 A G 17: 35,682,622 probably null Het
Dnah7c A C 1: 46,770,067 D3515A probably damaging Het
Elovl4 G A 9: 83,790,119 T49M probably damaging Het
Fam13b A T 18: 34,498,007 F40I probably damaging Het
Fancd2os T C 6: 113,597,640 H135R probably benign Het
Fer1l6 A G 15: 58,638,026 I1446V probably damaging Het
Fyb2 T A 4: 104,999,348 Y584* probably null Het
Galnt16 A T 12: 80,597,135 L442F probably damaging Het
Garem1 T A 18: 21,299,916 probably benign Het
Ggta1 C T 2: 35,402,428 R289Q probably damaging Het
Gm11564 T C 11: 99,815,521 T28A unknown Het
Hcn1 A G 13: 117,975,425 T642A unknown Het
Hhat A T 1: 192,726,304 L173H probably damaging Het
Hook1 T G 4: 96,017,597 I585S probably benign Het
Ighg1 A T 12: 113,329,729 S114T Het
Kmt2d G A 15: 98,852,018 P2598L unknown Het
Macc1 A T 12: 119,447,519 H674L probably benign Het
Mypn T C 10: 63,193,131 E51G probably benign Het
Olfr1012 A C 2: 85,759,459 L306V probably benign Het
Olfr134 T A 17: 38,175,297 M71K probably benign Het
Olfr862 A G 9: 19,884,176 V43A probably benign Het
Pnliprp2 T A 19: 58,775,142 S408T probably benign Het
Ppara A C 15: 85,777,726 Y56S probably benign Het
Ppp1r1a A G 15: 103,532,389 C114R probably benign Het
Pycard C T 7: 127,993,485 V57I probably damaging Het
Rin3 T G 12: 102,350,941 Y143D unknown Het
Slitrk3 C T 3: 73,050,107 R444H probably damaging Het
Ttf2 C T 3: 100,950,412 probably null Het
Ufsp2 T A 8: 45,980,324 I25N probably benign Het
Uqcrc2 A G 7: 120,641,689 T115A possibly damaging Het
Vmn2r43 T A 7: 8,255,231 R328* probably null Het
Vmn2r8 T A 5: 108,802,174 Y269F possibly damaging Het
Zbtb5 T C 4: 44,995,030 Y118C probably damaging Het
Zeb1 T C 18: 5,766,611 V374A probably damaging Het
Other mutations in Slc12a7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00763:Slc12a7 APN 13 73794082 missense possibly damaging 0.77
IGL01086:Slc12a7 APN 13 73814843 missense probably damaging 1.00
IGL01344:Slc12a7 APN 13 73792737 missense probably damaging 1.00
IGL01739:Slc12a7 APN 13 73799614 missense probably benign 0.00
IGL02039:Slc12a7 APN 13 73809094 critical splice donor site probably null
IGL02213:Slc12a7 APN 13 73797703 critical splice donor site probably null
IGL02285:Slc12a7 APN 13 73795595 unclassified probably benign
IGL02422:Slc12a7 APN 13 73806161 missense probably benign 0.18
IGL02423:Slc12a7 APN 13 73763763 utr 5 prime probably benign
IGL02596:Slc12a7 APN 13 73785123 missense probably benign 0.01
IGL02794:Slc12a7 APN 13 73809087 missense possibly damaging 0.68
IGL02813:Slc12a7 APN 13 73813676 unclassified probably benign
IGL02868:Slc12a7 APN 13 73806388 missense probably benign
R0828:Slc12a7 UTSW 13 73788652 missense probably benign 0.03
R1440:Slc12a7 UTSW 13 73801008 missense probably damaging 1.00
R1659:Slc12a7 UTSW 13 73790671 missense probably damaging 1.00
R1669:Slc12a7 UTSW 13 73795113 missense probably benign 0.00
R2111:Slc12a7 UTSW 13 73785155 nonsense probably null
R3023:Slc12a7 UTSW 13 73800422 missense probably benign 0.07
R3612:Slc12a7 UTSW 13 73809923 missense probably benign 0.30
R4210:Slc12a7 UTSW 13 73814843 missense probably damaging 1.00
R4353:Slc12a7 UTSW 13 73790734 missense possibly damaging 0.63
R4761:Slc12a7 UTSW 13 73813589 missense probably benign 0.06
R4801:Slc12a7 UTSW 13 73763892 critical splice donor site probably null
R4802:Slc12a7 UTSW 13 73763892 critical splice donor site probably null
R5002:Slc12a7 UTSW 13 73763777 missense possibly damaging 0.66
R5128:Slc12a7 UTSW 13 73805433 missense probably benign 0.03
R5594:Slc12a7 UTSW 13 73785139 missense probably benign
R5760:Slc12a7 UTSW 13 73813622 missense probably damaging 1.00
R5854:Slc12a7 UTSW 13 73793940 missense probably benign 0.03
R6233:Slc12a7 UTSW 13 73805471 missense possibly damaging 0.63
R6693:Slc12a7 UTSW 13 73797537 missense probably benign 0.00
R6782:Slc12a7 UTSW 13 73798969 missense probably damaging 0.99
R7169:Slc12a7 UTSW 13 73784560 missense probably benign 0.30
R7225:Slc12a7 UTSW 13 73763962 intron probably benign
R7458:Slc12a7 UTSW 13 73785069 missense probably damaging 1.00
R7565:Slc12a7 UTSW 13 73790772 missense possibly damaging 0.58
R7660:Slc12a7 UTSW 13 73806089 missense probably benign
R7737:Slc12a7 UTSW 13 73788677 missense probably benign 0.01
R7783:Slc12a7 UTSW 13 73805469 missense probably benign 0.44
R7875:Slc12a7 UTSW 13 73788604 missense possibly damaging 0.94
R8017:Slc12a7 UTSW 13 73799720 missense probably damaging 1.00
R8019:Slc12a7 UTSW 13 73799720 missense probably damaging 1.00
R8281:Slc12a7 UTSW 13 73790677 missense probably damaging 1.00
R8342:Slc12a7 UTSW 13 73785162 missense probably benign
R8747:Slc12a7 UTSW 13 73785122 missense probably benign 0.30
R8920:Slc12a7 UTSW 13 73798449 missense probably damaging 1.00
R9292:Slc12a7 UTSW 13 73784588 missense possibly damaging 0.46
R9381:Slc12a7 UTSW 13 73800944 missense probably benign 0.00
R9400:Slc12a7 UTSW 13 73784570 missense probably benign 0.00
X0023:Slc12a7 UTSW 13 73788608 missense possibly damaging 0.94
X0028:Slc12a7 UTSW 13 73798541 splice site probably null
X0065:Slc12a7 UTSW 13 73800945 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AGAGCGTGGATCAAACCTCC -3'
(R):5'- AACCAAGTAGTTTCCGGTGC -3'

Sequencing Primer
(F):5'- GTGGATCAAACCTCCCCTACG -3'
(R):5'- CAAGTAGTTTCCGGTGCTCCAG -3'
Posted On 2020-02-07