Incidental Mutation 'R7519:Fbxo15'
ID628208
Institutional Source Beutler Lab
Gene Symbol Fbxo15
Ensembl Gene ENSMUSG00000034391
Gene NameF-box protein 15
SynonymsFbx15, ecat3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7519 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location84934782-84981472 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to G at 84964234 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153105 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037718] [ENSMUST00000224467] [ENSMUST00000225015] [ENSMUST00000225445]
Predicted Effect probably benign
Transcript: ENSMUST00000037718
SMART Domains Protein: ENSMUSP00000045925
Gene: ENSMUSG00000034391

DomainStartEndE-ValueType
low complexity region 35 42 N/A INTRINSIC
FBOX 46 86 3.4e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000224467
Predicted Effect probably benign
Transcript: ENSMUST00000225015
Predicted Effect unknown
Transcript: ENSMUST00000225445
AA Change: H270Q
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the F-box protein family, such as FBXO15, are characterized by an approximately 40-amino acid F-box motif. SCF complexes, formed by SKP1 (MIM 601434), cullin (see CUL1; MIM 603134), and F-box proteins, act as protein-ubiquitin ligases. F-box proteins interact with SKP1 through the F box, and they interact with ubiquitination targets through other protein interaction domains (Jin et al., 2004 [PubMed 15520277]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Both male and female homozygous null mice develop normally and are fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik G A 7: 27,574,730 R132K Het
Acaca T C 11: 84,245,856 S571P probably damaging Het
Adamts20 T G 15: 94,325,988 K1286N possibly damaging Het
Adamts7 A G 9: 90,197,079 D1477G probably benign Het
Alox12b C T 11: 69,163,213 T207I probably benign Het
Arid1b GGGCGGCGGCGGCGGCGGCGGCGG GGGCGGCGGCGGCGGCGGCGGCGGCGGCGG 17: 4,995,844 probably benign Het
Arid1b CGGCGG CGGCGGTGGCGG 17: 4,995,853 probably benign Het
Aspm T A 1: 139,490,336 N2934K possibly damaging Het
Axin2 T G 11: 108,942,246 V419G probably benign Het
B4galnt4 A G 7: 141,064,344 T108A probably damaging Het
Cacna1s G A 1: 136,070,756 R174Q probably damaging Het
Cdh18 G T 15: 23,474,212 A723S possibly damaging Het
Ces4a T C 8: 105,145,219 M307T probably damaging Het
Cobl T A 11: 12,253,124 I1193F probably damaging Het
Crb2 G T 2: 37,793,320 G945W probably damaging Het
Ctnna1 T G 18: 35,174,371 I140M probably benign Het
Dnah5 T C 15: 28,390,483 S3213P probably damaging Het
Fbln7 A G 2: 128,893,865 S258G probably benign Het
Fcgbp A G 7: 28,086,299 Y387C probably damaging Het
Flt3l G A 7: 45,133,845 T176I unknown Het
Galk2 G A 2: 125,983,252 R456H possibly damaging Het
Gm10840 T C 11: 106,160,890 L14P unknown Het
Gm5591 T C 7: 38,520,670 T260A possibly damaging Het
Gm6370 T A 5: 146,493,828 D274E probably damaging Het
Grhl2 T A 15: 37,336,312 D484E probably damaging Het
Hbp1 A T 12: 31,933,375 V360D probably damaging Het
Heatr5b G T 17: 78,755,217 Q1968K probably benign Het
Igsf8 C T 1: 172,316,307 T72M probably benign Het
Kera A T 10: 97,609,022 N81I probably damaging Het
Klhl14 C T 18: 21,651,843 V176I probably benign Het
Klrb1 A T 6: 128,712,289 V73E probably damaging Het
Krtap31-2 T C 11: 99,936,675 L111P possibly damaging Het
Mbtd1 T C 11: 93,908,899 S106P probably damaging Het
Nckap5l T C 15: 99,426,247 T792A probably benign Het
Ndufaf4 A C 4: 24,901,847 T132P probably damaging Het
Neo1 A G 9: 58,878,065 V1453A probably benign Het
Olfr1136 T C 2: 87,693,409 I158V probably benign Het
Olfr809 A C 10: 129,776,222 I103L probably benign Het
Pcdha11 T A 18: 37,006,266 L316* probably null Het
Pcdha7 T C 18: 36,976,232 M770T possibly damaging Het
Pcsk1 T C 13: 75,110,865 S253P probably damaging Het
Phtf1 T C 3: 103,969,119 Y12H probably damaging Het
Pkd1l2 T C 8: 117,065,529 N508S probably benign Het
Pla1a A G 16: 38,414,846 I162T possibly damaging Het
Rb1 A T 14: 73,264,608 L446M probably damaging Het
Retn A T 8: 3,656,079 S22C probably damaging Het
Snx25 A G 8: 46,116,272 L196P probably damaging Het
Sp110 G A 1: 85,579,092 R417C Het
Spata31d1b G A 13: 59,716,912 D625N probably benign Het
Sycp2 T C 2: 178,346,333 *1501W probably null Het
Tarbp1 T G 8: 126,433,900 T1271P possibly damaging Het
Uba1y T C Y: 821,567 F154L probably benign Het
Ubr1 T A 2: 120,875,444 I1513F possibly damaging Het
Vmn2r110 T A 17: 20,584,262 Q132L probably benign Het
Vwf A T 6: 125,667,543 T2454S Het
Wdr33 C A 18: 31,896,770 F1007L unknown Het
Zfp398 A G 6: 47,859,473 H201R probably benign Het
Other mutations in Fbxo15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00517:Fbxo15 APN 18 84959100 missense probably damaging 1.00
IGL01375:Fbxo15 APN 18 84958279 missense possibly damaging 0.64
IGL01730:Fbxo15 APN 18 84964174 missense probably benign 0.38
IGL01807:Fbxo15 APN 18 84981381 utr 3 prime probably benign
IGL02220:Fbxo15 APN 18 84964192 critical splice donor site probably null
IGL02255:Fbxo15 APN 18 84964196 splice site probably null
IGL02435:Fbxo15 APN 18 84959226 missense probably damaging 0.97
IGL02546:Fbxo15 APN 18 84962722 critical splice donor site probably null
IGL03099:Fbxo15 APN 18 84981213 missense possibly damaging 0.87
R0346:Fbxo15 UTSW 18 84960221 critical splice donor site probably null
R1606:Fbxo15 UTSW 18 84962620 missense possibly damaging 0.93
R1671:Fbxo15 UTSW 18 84959106 missense possibly damaging 0.73
R2113:Fbxo15 UTSW 18 84959105 missense probably benign 0.00
R3962:Fbxo15 UTSW 18 84959247 missense probably benign 0.02
R4064:Fbxo15 UTSW 18 84959118 missense probably damaging 0.96
R5523:Fbxo15 UTSW 18 84960069 missense probably damaging 1.00
R5931:Fbxo15 UTSW 18 84981125 missense probably damaging 0.96
R6235:Fbxo15 UTSW 18 84980904 intron probably benign
R6349:Fbxo15 UTSW 18 84964142 missense probably benign 0.01
R6607:Fbxo15 UTSW 18 84959145 missense possibly damaging 0.88
R7232:Fbxo15 UTSW 18 84962622 missense probably damaging 1.00
R7325:Fbxo15 UTSW 18 84959118 missense probably damaging 0.96
R7671:Fbxo15 UTSW 18 84964153 missense probably damaging 1.00
R8094:Fbxo15 UTSW 18 84965493 missense probably benign 0.34
R8365:Fbxo15 UTSW 18 84962614 missense probably damaging 1.00
X0022:Fbxo15 UTSW 18 84960119 missense probably benign 0.00
Z1177:Fbxo15 UTSW 18 84958308 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCTGGGATTTTCATGATGAACTTC -3'
(R):5'- TGGCACCATGCTAACAGAAGAG -3'

Sequencing Primer
(F):5'- TCAGGAGAATGGTGGACT -3'
(R):5'- TGCTAACAGAAGAGATCACCCCTG -3'
Posted On2020-02-07