Incidental Mutation 'R0715:Mmp27'
ID 62821
Institutional Source Beutler Lab
Gene Symbol Mmp27
Ensembl Gene ENSMUSG00000070323
Gene Name matrix metallopeptidase 27
Synonyms LOC234911
MMRRC Submission 038898-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.059) question?
Stock # R0715 (G1)
Quality Score 144
Status Validated
Chromosome 9
Chromosomal Location 7571397-7581886 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to C at 7581156 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000120900] [ENSMUST00000151853]
AlphaFold D3YV89
Predicted Effect probably benign
Transcript: ENSMUST00000093896
SMART Domains Protein: ENSMUSP00000091423
Gene: ENSMUSG00000070323

DomainStartEndE-ValueType
Pfam:PG_binding_1 40 100 1.4e-13 PFAM
ZnMc 116 303 1.81e-43 SMART
HX 326 368 5.97e-4 SMART
HX 370 412 1.1e-7 SMART
HX 417 464 1.09e-6 SMART
HX 466 506 3.2e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120900
SMART Domains Protein: ENSMUSP00000113231
Gene: ENSMUSG00000070323

DomainStartEndE-ValueType
Pfam:PG_binding_1 40 100 1e-13 PFAM
ZnMc 116 277 1.76e-50 SMART
HX 300 342 5.97e-4 SMART
HX 344 386 1.1e-7 SMART
HX 391 438 1.09e-6 SMART
HX 440 480 3.2e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000151853
SMART Domains Protein: ENSMUSP00000117469
Gene: ENSMUSG00000070323

DomainStartEndE-ValueType
Pfam:PG_binding_1 40 100 1.1e-13 PFAM
ZnMc 116 303 1.81e-43 SMART
HX 326 368 5.97e-4 SMART
HX 370 412 1.1e-7 SMART
HX 417 464 1.09e-6 SMART
HX 466 506 3.2e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152878
SMART Domains Protein: ENSMUSP00000116263
Gene: ENSMUSG00000070323

DomainStartEndE-ValueType
Pfam:PG_binding_1 39 99 1.1e-13 PFAM
ZnMc 115 295 1.41e-13 SMART
HX 245 287 5.97e-4 SMART
HX 289 331 1.1e-7 SMART
HX 336 383 1.09e-6 SMART
HX 385 425 3.2e-4 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Proteins of the matrix metalloproteinase (MMP) family are involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, and tissue remodeling, as well as in disease processes, such as arthritis and metastasis. Most MMP's are secreted as inactive proproteins which are activated when cleaved by extracellular proteinases. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik A G 11: 58,179,176 (GRCm39) Y170C probably damaging Het
Adcy2 C T 13: 69,036,161 (GRCm39) V167I probably benign Het
Agl A G 3: 116,545,825 (GRCm39) Y1324H probably damaging Het
Arhgef37 G T 18: 61,641,860 (GRCm39) Q170K probably damaging Het
Asah2 A G 19: 31,994,176 (GRCm39) S390P probably damaging Het
Atp8a1 A T 5: 67,932,068 (GRCm39) H240Q probably benign Het
Btbd16 T A 7: 130,390,557 (GRCm39) N151K probably damaging Het
Ccdc73 T A 2: 104,803,499 (GRCm39) probably benign Het
Cecr2 G T 6: 120,735,159 (GRCm39) M21I probably benign Het
Ckap2l T C 2: 129,127,636 (GRCm39) T181A probably benign Het
Col4a3 T C 1: 82,629,879 (GRCm39) probably benign Het
Cplane1 T A 15: 8,252,576 (GRCm39) C1933S probably benign Het
Dnah9 A G 11: 65,972,074 (GRCm39) probably benign Het
Efcab3 T C 11: 104,611,706 (GRCm39) L516P possibly damaging Het
Fat3 T C 9: 16,286,419 (GRCm39) T1035A probably benign Het
Fzd8 A G 18: 9,212,947 (GRCm39) T10A unknown Het
Gm9631 C A 11: 121,833,328 (GRCm39) C636F probably damaging Het
Gp1ba A G 11: 70,531,614 (GRCm39) probably benign Het
Gsk3a A G 7: 24,931,134 (GRCm39) V277A probably damaging Het
H2-M1 T A 17: 36,981,120 (GRCm39) probably benign Het
Hesx1 T A 14: 26,722,809 (GRCm39) W45R probably damaging Het
Il23r T A 6: 67,463,317 (GRCm39) M59L possibly damaging Het
Insc T A 7: 114,444,312 (GRCm39) V433E probably benign Het
Itga8 T C 2: 12,196,053 (GRCm39) probably benign Het
Kif13a T A 13: 46,966,299 (GRCm39) E436V probably damaging Het
Liph A G 16: 21,814,100 (GRCm39) F7S probably benign Het
Lpar2 T C 8: 70,276,823 (GRCm39) V204A probably damaging Het
Lrfn4 T A 19: 4,662,668 (GRCm39) probably null Het
Man2b2 A T 5: 36,983,402 (GRCm39) D182E probably benign Het
Mrm1 A G 11: 84,705,639 (GRCm39) probably benign Het
Mtx3 T C 13: 92,986,869 (GRCm39) S271P probably damaging Het
Myh11 A T 16: 14,044,480 (GRCm39) M641K possibly damaging Het
Necab2 A G 8: 120,197,670 (GRCm39) D332G probably damaging Het
Ngfr A G 11: 95,465,065 (GRCm39) I261T possibly damaging Het
Nrap T C 19: 56,345,757 (GRCm39) E617G probably damaging Het
Obscn G T 11: 58,941,306 (GRCm39) T4505K probably benign Het
Or8b37 G T 9: 37,959,123 (GRCm39) V202L probably benign Het
Or8b57 A G 9: 40,003,807 (GRCm39) Y148H probably damaging Het
Osbpl11 T A 16: 33,062,100 (GRCm39) probably benign Het
Otof A G 5: 30,552,041 (GRCm39) V301A probably damaging Het
Phf3 A T 1: 30,850,919 (GRCm39) L1145Q probably damaging Het
Phospho2 T A 2: 69,626,540 (GRCm39) I232N possibly damaging Het
Pomgnt2 T A 9: 121,811,127 (GRCm39) K551N probably damaging Het
Ptchd3 A G 11: 121,721,984 (GRCm39) T286A possibly damaging Het
Rnf213 A G 11: 119,331,976 (GRCm39) D2396G probably damaging Het
Sh3pxd2b A G 11: 32,373,341 (GRCm39) E836G possibly damaging Het
Simc1 G T 13: 54,673,468 (GRCm39) M605I possibly damaging Het
Slc12a3 G A 8: 95,056,061 (GRCm39) E66K possibly damaging Het
Spg11 T C 2: 121,915,464 (GRCm39) N1060S probably benign Het
Supt5 A T 7: 28,028,462 (GRCm39) W178R probably damaging Het
Tmem41a G T 16: 21,756,740 (GRCm39) F126L probably benign Het
Ube2m T A 7: 12,771,553 (GRCm39) Q35L probably benign Het
Usp33 A G 3: 152,086,211 (GRCm39) D658G probably damaging Het
Vmn2r12 A T 5: 109,238,373 (GRCm39) C456S probably benign Het
Vmn2r81 T A 10: 79,104,434 (GRCm39) D352E probably damaging Het
Zfp516 A G 18: 83,005,388 (GRCm39) Y764C probably damaging Het
Zswim7 A G 11: 62,167,473 (GRCm39) probably benign Het
Other mutations in Mmp27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00544:Mmp27 APN 9 7,573,505 (GRCm39) splice site probably benign
IGL00656:Mmp27 APN 9 7,581,383 (GRCm39) missense possibly damaging 0.80
IGL00937:Mmp27 APN 9 7,578,900 (GRCm39) critical splice acceptor site probably benign 0.00
IGL01101:Mmp27 APN 9 7,573,416 (GRCm39) missense probably damaging 1.00
IGL01134:Mmp27 APN 9 7,573,298 (GRCm39) missense probably benign 0.06
IGL01631:Mmp27 APN 9 7,573,289 (GRCm39) critical splice acceptor site probably benign 0.00
IGL02967:Mmp27 APN 9 7,571,591 (GRCm39) missense probably benign 0.03
IGL03024:Mmp27 APN 9 7,581,377 (GRCm39) missense probably benign 0.17
R0662:Mmp27 UTSW 9 7,577,651 (GRCm39) missense probably benign 0.00
R0826:Mmp27 UTSW 9 7,579,010 (GRCm39) missense probably damaging 1.00
R1191:Mmp27 UTSW 9 7,579,067 (GRCm39) splice site probably null
R1793:Mmp27 UTSW 9 7,571,459 (GRCm39) start codon destroyed probably null 0.00
R1983:Mmp27 UTSW 9 7,578,898 (GRCm39) splice site probably null
R2074:Mmp27 UTSW 9 7,577,740 (GRCm39) missense possibly damaging 0.50
R2172:Mmp27 UTSW 9 7,577,379 (GRCm39) nonsense probably null
R2445:Mmp27 UTSW 9 7,581,182 (GRCm39) missense probably benign 0.12
R2961:Mmp27 UTSW 9 7,573,603 (GRCm39) missense probably damaging 1.00
R4825:Mmp27 UTSW 9 7,581,195 (GRCm39) missense probably damaging 1.00
R4888:Mmp27 UTSW 9 7,581,369 (GRCm39) missense probably benign 0.00
R4938:Mmp27 UTSW 9 7,578,983 (GRCm39) missense probably damaging 0.97
R5095:Mmp27 UTSW 9 7,572,159 (GRCm39) missense probably damaging 1.00
R5095:Mmp27 UTSW 9 7,579,001 (GRCm39) missense probably damaging 1.00
R5121:Mmp27 UTSW 9 7,581,369 (GRCm39) missense probably benign 0.00
R5446:Mmp27 UTSW 9 7,573,516 (GRCm39) splice site probably benign
R5485:Mmp27 UTSW 9 7,573,363 (GRCm39) missense probably damaging 1.00
R5516:Mmp27 UTSW 9 7,579,063 (GRCm39) missense probably null 1.00
R6682:Mmp27 UTSW 9 7,573,606 (GRCm39) missense probably benign 0.02
R6712:Mmp27 UTSW 9 7,572,177 (GRCm39) missense probably damaging 1.00
R6737:Mmp27 UTSW 9 7,571,955 (GRCm39) missense possibly damaging 0.78
R7282:Mmp27 UTSW 9 7,578,231 (GRCm39) missense probably damaging 0.98
R7368:Mmp27 UTSW 9 7,577,318 (GRCm39) missense probably damaging 1.00
R7689:Mmp27 UTSW 9 7,579,002 (GRCm39) missense probably damaging 1.00
R8006:Mmp27 UTSW 9 7,578,985 (GRCm39) missense probably damaging 0.97
R8185:Mmp27 UTSW 9 7,573,492 (GRCm39) missense unknown
R8537:Mmp27 UTSW 9 7,579,776 (GRCm39) missense probably benign 0.00
R9039:Mmp27 UTSW 9 7,581,250 (GRCm39) missense probably benign 0.01
R9087:Mmp27 UTSW 9 7,579,858 (GRCm39) missense probably damaging 1.00
R9188:Mmp27 UTSW 9 7,579,792 (GRCm39) missense possibly damaging 0.55
R9280:Mmp27 UTSW 9 7,579,812 (GRCm39) missense probably benign 0.09
R9367:Mmp27 UTSW 9 7,573,550 (GRCm39) missense probably damaging 1.00
X0021:Mmp27 UTSW 9 7,573,299 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCACACTCAGAGATGCTTTGACAC -3'
(R):5'- TCTTCCTGAGGCAGAGTTCAGGTT -3'

Sequencing Primer
(F):5'- CAGAGATGCTTTGACACTTGTGC -3'
(R):5'- TACTGAAAGTGAGCAAGCTTAACC -3'
Posted On 2013-07-30