Incidental Mutation 'R7594:Cox16'
ID628211
Institutional Source Beutler Lab
Gene Symbol Cox16
Ensembl Gene ENSMUSG00000091803
Gene Namecytochrome c oxidase assembly protein 16
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R7594 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location81359026-81485127 bp(-) (GRCm38)
Type of Mutationsplice site (9 bp from exon)
DNA Base Change (assembly) A to T at 81474578 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127295 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002757] [ENSMUST00000110340] [ENSMUST00000164386] [ENSMUST00000166664] [ENSMUST00000166723] [ENSMUST00000168463] [ENSMUST00000169124] [ENSMUST00000171459]
Predicted Effect probably null
Transcript: ENSMUST00000002757
SMART Domains Protein: ENSMUSP00000002757
Gene: ENSMUSG00000091803

DomainStartEndE-ValueType
Pfam:COX16 16 88 1.8e-24 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000110340
SMART Domains Protein: ENSMUSP00000105969
Gene: ENSMUSG00000091803

DomainStartEndE-ValueType
Pfam:COX16 16 74 6.6e-17 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000164386
SMART Domains Protein: ENSMUSP00000132941
Gene: ENSMUSG00000021139

DomainStartEndE-ValueType
PDZ 21 100 6.16e-24 SMART
Predicted Effect probably null
Transcript: ENSMUST00000166664
SMART Domains Protein: ENSMUSP00000131728
Gene: ENSMUSG00000021139

DomainStartEndE-ValueType
PDZ 21 100 6.16e-24 SMART
Predicted Effect probably null
Transcript: ENSMUST00000166723
SMART Domains Protein: ENSMUSP00000130935
Gene: ENSMUSG00000091803

DomainStartEndE-ValueType
Pfam:COX16 16 73 6.9e-16 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000168463
SMART Domains Protein: ENSMUSP00000127295
Gene: ENSMUSG00000091803

DomainStartEndE-ValueType
Pfam:COX16 16 78 2e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169124
SMART Domains Protein: ENSMUSP00000128281
Gene: ENSMUSG00000091803

DomainStartEndE-ValueType
Pfam:COX16 16 69 3.2e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171459
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (62/63)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930516K23Rik T C 7: 104,059,263 E113G probably damaging Het
9530053A07Rik T C 7: 28,131,460 C33R probably damaging Het
Acsm3 A G 7: 119,784,990 probably null Het
Acvr2a T A 2: 48,894,737 L345* probably null Het
App T C 16: 85,080,002 D167G unknown Het
Arhgef33 A G 17: 80,370,305 D427G probably damaging Het
Arid2 T C 15: 96,390,994 S1675P probably damaging Het
Atp8a1 T C 5: 67,651,592 Y985C Het
AW209491 A G 13: 14,637,246 D228G probably benign Het
Casc3 G A 11: 98,821,485 A117T probably benign Het
Cass4 C T 2: 172,429,648 P645S probably benign Het
Ccar2 A T 14: 70,141,794 Y553* probably null Het
Cpeb3 A T 19: 37,174,151 V275E possibly damaging Het
Dido1 A G 2: 180,675,112 V634A probably benign Het
Dnajb1 G A 8: 83,609,844 S81N probably benign Het
Dst A G 1: 34,213,013 K2262E probably damaging Het
Eya3 T C 4: 132,694,825 V237A probably benign Het
Fbxo31 T A 8: 121,552,368 D460V probably damaging Het
Gabrg3 A T 7: 56,982,695 N168K possibly damaging Het
Ggh C G 4: 20,049,833 S88C probably damaging Het
Gm10134 T C 2: 28,506,360 M89T unknown Het
Gm13084 A T 4: 143,812,716 I69N probably damaging Het
Kif17 T C 4: 138,277,925 L267P probably damaging Het
Ksr2 C A 5: 117,555,066 T193N possibly damaging Het
Lmtk2 T C 5: 144,173,746 L428P probably damaging Het
Mdn1 G T 4: 32,696,359 L1247F probably benign Het
Med24 T C 11: 98,715,097 Y323C probably damaging Het
Mthfd2 A G 6: 83,306,683 V339A probably benign Het
Mtus2 G T 5: 148,077,406 R336S probably benign Het
Muc16 T C 9: 18,645,062 T3312A unknown Het
Nacad A G 11: 6,602,457 S245P probably damaging Het
Nacc1 T C 8: 84,675,002 D394G probably damaging Het
Nfatc2 A G 2: 168,523,348 V582A probably damaging Het
Nid2 T A 14: 19,768,723 D428E probably benign Het
Olfr1122 A G 2: 87,388,269 H188R probably damaging Het
Olfr1253 T A 2: 89,752,562 T89S probably benign Het
Olfr684 A G 7: 105,157,673 L3S probably benign Het
Osbpl5 A T 7: 143,693,797 L768Q probably benign Het
Plch2 C T 4: 155,007,027 V210I probably damaging Het
Plekhh1 C T 12: 79,076,503 T1153I possibly damaging Het
Ppp1r14c T C 10: 3,366,670 S2P possibly damaging Het
Psmd5 G T 2: 34,860,729 H239Q probably benign Het
Ptcd2 C A 13: 99,320,282 A345S possibly damaging Het
Sap30l G A 11: 57,810,121 probably null Het
Sec14l2 A G 11: 4,111,213 Y83H probably damaging Het
Slc2a9 A G 5: 38,351,291 I470T probably benign Het
Sp110 G A 1: 85,579,092 R417C Het
Syne1 A G 10: 5,215,190 probably null Het
Tg T A 15: 66,729,583 D1766E probably benign Het
Tlr12 T C 4: 128,617,680 E259G probably benign Het
Tlr6 T C 5: 64,953,251 Y771C probably damaging Het
Tnrc6b T A 15: 80,880,307 V670E possibly damaging Het
Top2b A G 14: 16,428,587 T1522A probably benign Het
Tpcn1 A G 5: 120,556,530 M158T possibly damaging Het
Ttn T C 2: 76,726,842 I29940V probably benign Het
Ttn G A 2: 76,751,354 T23065I probably damaging Het
Umodl1 A G 17: 30,954,805 S20G probably benign Het
Uts2r G T 11: 121,161,365 V352F possibly damaging Het
Vmn1r67 T A 7: 10,447,415 M202K possibly damaging Het
Vmn2r107 T C 17: 20,360,373 V524A probably benign Het
Zc3h12d C A 10: 7,862,618 D229E probably damaging Het
Zfp541 A G 7: 16,076,386 D116G probably damaging Het
Zfp971 A G 2: 178,034,000 E464G possibly damaging Het
Other mutations in Cox16
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1332:Cox16 UTSW 12 81472290 missense probably damaging 1.00
R1336:Cox16 UTSW 12 81472290 missense probably damaging 1.00
R1489:Cox16 UTSW 12 81474615 missense probably null 0.99
R4079:Cox16 UTSW 12 81474335 unclassified probably benign
R4284:Cox16 UTSW 12 81474519 intron probably null
R5509:Cox16 UTSW 12 81472258 missense probably benign 0.00
R5538:Cox16 UTSW 12 81484929 missense possibly damaging 0.92
R6356:Cox16 UTSW 12 81472341 missense probably damaging 1.00
R7126:Cox16 UTSW 12 81472166 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTCTAATACCCGGTGCTATAGAAC -3'
(R):5'- ACAAACAGTTTCAGGGTTTGGTG -3'

Sequencing Primer
(F):5'- GGTGCTATAGAACTTACTCCCCAG -3'
(R):5'- CCAGTTGGGGCATCTCTCTG -3'
Posted On2020-02-10