Incidental Mutation 'R7642:Wdr36'
ID628214
Institutional Source Beutler Lab
Gene Symbol Wdr36
Ensembl Gene ENSMUSG00000038299
Gene NameWD repeat domain 36
Synonyms5730444A13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7642 (G1)
Quality Score113.008
Status Validated
Chromosome18
Chromosomal Location32837225-32866420 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 32854571 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000132189 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053663] [ENSMUST00000166214]
Predicted Effect probably null
Transcript: ENSMUST00000053663
SMART Domains Protein: ENSMUSP00000052465
Gene: ENSMUSG00000038299

DomainStartEndE-ValueType
WD40 98 135 3.21e-1 SMART
Blast:WD40 140 180 3e-15 BLAST
WD40 183 222 9.21e0 SMART
WD40 226 265 1.43e0 SMART
WD40 268 308 5.35e-1 SMART
WD40 315 355 7.43e-1 SMART
WD40 473 515 1.46e-1 SMART
WD40 559 598 2.2e-10 SMART
WD40 601 640 1.43e1 SMART
Pfam:Utp21 673 895 9.7e-72 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000166214
SMART Domains Protein: ENSMUSP00000132189
Gene: ENSMUSG00000038299

DomainStartEndE-ValueType
WD40 98 135 3.21e-1 SMART
Blast:WD40 140 180 3e-15 BLAST
WD40 183 222 9.21e0 SMART
WD40 226 265 1.43e0 SMART
WD40 268 308 5.35e-1 SMART
WD40 315 355 7.43e-1 SMART
WD40 473 515 1.46e-1 SMART
WD40 559 598 2.2e-10 SMART
WD40 601 640 1.43e1 SMART
Pfam:Utp21 668 883 6.1e-72 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. Mutations in this gene have been associated with adult-onset primary open-angle glaucoma (POAG). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to complete embryonic lethality before implantation. In culture, homozygous mutant embryos fail to reach the blastocyst stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap3b1 T C 13: 94,477,032 S680P probably benign Het
Carmil1 T C 13: 24,067,206 T844A probably benign Het
Cfap57 C T 4: 118,614,931 V84I probably benign Het
Clca4a A T 3: 144,953,751 D781E probably benign Het
Col10a1 A G 10: 34,395,642 M537V probably benign Het
Col5a2 A G 1: 45,376,088 M1497T probably benign Het
Csmd1 T A 8: 16,085,178 I1655F probably damaging Het
Cts3 A G 13: 61,568,775 S16P probably benign Het
Cyp2c67 T C 19: 39,615,640 Y424C probably damaging Het
Dip2c T C 13: 9,622,705 probably null Het
Dnah5 T C 15: 28,247,979 probably null Het
Dpp4 A G 2: 62,360,283 probably null Het
Fam135b T G 15: 71,479,142 N295T possibly damaging Het
Fign A G 2: 63,980,572 V118A probably benign Het
Gpr108 A T 17: 57,236,228 Y480* probably null Het
Ky T C 9: 102,542,270 V492A probably benign Het
Lmf1 G A 17: 25,654,471 V317M probably damaging Het
Lrrc30 C T 17: 67,632,477 G36E probably damaging Het
Map2 T C 1: 66,413,307 V452A probably benign Het
Mks1 C T 11: 87,856,840 T183M possibly damaging Het
Mpg G A 11: 32,229,517 probably null Het
Nat10 A G 2: 103,726,786 L841P possibly damaging Het
Nbeal1 A G 1: 60,277,227 E1863G probably benign Het
Neurl1b C G 17: 26,438,746 H219Q probably benign Het
Nr2e3 T A 9: 59,947,388 I292F possibly damaging Het
Nxn T C 11: 76,272,459 Y246C probably damaging Het
Olfr1048 A T 2: 86,236,316 L166* probably null Het
Olfr1289 T C 2: 111,483,478 F44S probably damaging Het
Olfr194 T G 16: 59,119,648 T141P possibly damaging Het
Olfr196 A G 16: 59,167,717 V142A probably benign Het
Olfr98 A T 17: 37,263,073 M197K probably benign Het
Pcdha5 T A 18: 36,960,491 F18I probably benign Het
Pcdhb17 A G 18: 37,485,726 K190E probably damaging Het
Peg3 GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC 7: 6,709,168 probably benign Het
Ppm1g G T 5: 31,205,103 Y284* probably null Het
Rp1 A G 1: 4,147,831 V1026A unknown Het
Scap C T 9: 110,374,013 R252C probably damaging Het
Scn9a C A 2: 66,536,236 K734N probably benign Het
Sema5a C T 15: 32,682,325 S955F probably damaging Het
Serpinb10 A G 1: 107,529,101 probably null Het
Sfi1 ACA ACATCTTCCCAAAGCCAGTCA 11: 3,153,382 probably benign Het
Sh2d5 A G 4: 138,259,156 T397A probably benign Het
Slc22a8 T C 19: 8,610,045 F490L probably benign Het
Tbc1d19 A T 5: 53,856,918 Y296F probably damaging Het
Tmppe T C 9: 114,404,794 S54P possibly damaging Het
Vmn1r123 A T 7: 21,162,870 N229I probably benign Het
Wdr47 T A 3: 108,643,164 M835K possibly damaging Het
Wscd2 A T 5: 113,577,414 K438N possibly damaging Het
Xrcc6 T A 15: 82,016,477 probably null Het
Xrn1 T A 9: 96,021,853 F1148I possibly damaging Het
Zmynd8 T C 2: 165,812,426 D722G probably damaging Het
Other mutations in Wdr36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00925:Wdr36 APN 18 32845631 missense possibly damaging 0.86
IGL01975:Wdr36 APN 18 32852488 missense probably damaging 1.00
IGL02001:Wdr36 APN 18 32852888 missense probably damaging 1.00
IGL02605:Wdr36 APN 18 32851991 missense possibly damaging 0.94
IGL02625:Wdr36 APN 18 32859261 missense possibly damaging 0.51
IGL02928:Wdr36 APN 18 32847319 critical splice donor site probably null
R0025:Wdr36 UTSW 18 32859307 missense probably damaging 1.00
R0025:Wdr36 UTSW 18 32859307 missense probably damaging 1.00
R0062:Wdr36 UTSW 18 32864749 missense possibly damaging 0.90
R0062:Wdr36 UTSW 18 32864749 missense possibly damaging 0.90
R0331:Wdr36 UTSW 18 32852915 missense possibly damaging 0.83
R0626:Wdr36 UTSW 18 32850531 missense probably damaging 1.00
R0835:Wdr36 UTSW 18 32849082 missense possibly damaging 0.87
R1484:Wdr36 UTSW 18 32843885 missense possibly damaging 0.77
R1498:Wdr36 UTSW 18 32852968 missense possibly damaging 0.95
R3522:Wdr36 UTSW 18 32861485 splice site probably null
R4521:Wdr36 UTSW 18 32841148 splice site probably null
R4902:Wdr36 UTSW 18 32859261 missense possibly damaging 0.51
R5482:Wdr36 UTSW 18 32841904 missense probably benign 0.19
R5574:Wdr36 UTSW 18 32865959 missense probably damaging 1.00
R5627:Wdr36 UTSW 18 32861638 missense possibly damaging 0.73
R6076:Wdr36 UTSW 18 32846945 missense probably damaging 1.00
R6186:Wdr36 UTSW 18 32852901 missense probably benign 0.19
R6228:Wdr36 UTSW 18 32842006 missense possibly damaging 0.67
R7027:Wdr36 UTSW 18 32841905 missense probably benign 0.04
R7112:Wdr36 UTSW 18 32839451 missense probably benign 0.34
R7635:Wdr36 UTSW 18 32850525 missense probably benign 0.19
R7998:Wdr36 UTSW 18 32852519 missense probably damaging 1.00
R8200:Wdr36 UTSW 18 32865926 missense probably benign 0.10
R8203:Wdr36 UTSW 18 32852083 nonsense probably null
R8257:Wdr36 UTSW 18 32841286 intron probably benign
R8334:Wdr36 UTSW 18 32859293 missense possibly damaging 0.95
R8845:Wdr36 UTSW 18 32861045 nonsense probably null
R8894:Wdr36 UTSW 18 32837287 start gained probably benign
R8901:Wdr36 UTSW 18 32846960 missense probably damaging 1.00
X0063:Wdr36 UTSW 18 32864722 missense probably damaging 0.96
Z1088:Wdr36 UTSW 18 32866012 splice site probably null
Predicted Primers PCR Primer
(F):5'- GACAGCTTTCAGAGACATAGTATTAGC -3'
(R):5'- TTATCAACCAGCGGCCATCAG -3'

Sequencing Primer
(F):5'- CAGCTAAAATTAGACTGCAG -3'
(R):5'- GCCATCAGGACTGAACGTC -3'
Posted On2020-02-10