Incidental Mutation 'R7645:Adgrg3'
ID628216
Institutional Source Beutler Lab
Gene Symbol Adgrg3
Ensembl Gene ENSMUSG00000060470
Gene Nameadhesion G protein-coupled receptor G3
SynonymsGpr97, Pb99, A030001G24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7645 (G1)
Quality Score131.008
Status Validated
Chromosome8
Chromosomal Location95017692-95045250 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 95034764 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000051079 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051259]
Predicted Effect probably benign
Transcript: ENSMUST00000051259
SMART Domains Protein: ENSMUSP00000051079
Gene: ENSMUSG00000060470

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
GPS 209 256 3.45e-11 SMART
Pfam:7tm_2 260 509 5.1e-33 PFAM
low complexity region 520 531 N/A INTRINSIC
Predicted Effect
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (46/47)
MGI Phenotype PHENOTYPE: Homozygous null mice display normal B and T cell development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actbl2 T A 13: 111,256,255 C375S probably benign Het
Amn1 C T 6: 149,185,031 M44I probably benign Het
Atg2b T C 12: 105,623,430 Y1854C probably benign Het
Bcat2 T A 7: 45,587,963 N290K probably benign Het
Ccdc39 T C 3: 33,825,169 probably null Het
Cnot10 T C 9: 114,613,637 S501G probably benign Het
Col6a6 A G 9: 105,767,198 probably null Het
Coq2 A C 5: 100,660,250 C228W probably damaging Het
Cpt2 A T 4: 107,906,974 M531K possibly damaging Het
Dennd1a A G 2: 38,021,363 L204P probably damaging Het
Dirc2 T A 16: 35,734,068 probably null Het
Dock9 C T 14: 121,597,663 V1305M probably benign Het
Dusp16 A G 6: 134,725,925 I201T probably damaging Het
Esco2 T C 14: 65,827,181 D370G probably benign Het
Fbxl4 T C 4: 22,377,037 S158P probably damaging Het
Fut10 A G 8: 31,236,204 H329R possibly damaging Het
Gm10436 T C 12: 88,176,258 T392A probably damaging Het
Gpr3 A G 4: 133,211,329 W11R probably damaging Het
H2-M3 T A 17: 37,270,729 I94N probably damaging Het
Krt7 T C 15: 101,412,643 I57T probably damaging Het
Ltc4s T C 11: 50,238,546 probably benign Het
Ms4a6b A T 19: 11,523,940 T105S probably damaging Het
Muc6 T C 7: 141,648,658 H592R probably benign Het
Ncam1 T C 9: 49,565,003 E262G probably benign Het
Olfr1265 T A 2: 90,037,747 I276K possibly damaging Het
Olfr1462 T C 19: 13,191,573 V302A probably benign Het
Plxnb1 T A 9: 109,114,412 S1908T probably damaging Het
Polg2 A T 11: 106,775,593 M242K probably benign Het
Polr3g T C 13: 81,694,444 T151A unknown Het
Psmb8 T C 17: 34,200,212 L160P possibly damaging Het
Rab5b G A 10: 128,681,391 A176V possibly damaging Het
Rreb1 T C 13: 37,931,034 C790R probably damaging Het
Rufy3 A G 5: 88,640,617 T506A probably benign Het
Samd11 T C 4: 156,255,183 probably benign Het
Slc12a2 T C 18: 57,896,378 F279L possibly damaging Het
Son TCCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCAGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG TCCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,295 probably benign Het
Srgn C T 10: 62,494,978 W116* probably null Het
Svil A G 18: 5,099,663 E1733G probably damaging Het
Tbc1d22a C T 15: 86,235,541 P49S probably benign Het
Tbc1d9 A T 8: 83,242,553 K490M probably damaging Het
Tcte1 A G 17: 45,534,989 N173S probably benign Het
Tmco6 C T 18: 36,735,393 R31W probably damaging Het
Ttn C A 2: 76,899,681 A5155S unknown Het
Tyro3 T C 2: 119,816,906 Y839H probably damaging Het
Zc3h12d A G 10: 7,867,576 D370G probably benign Het
Zc3h7b T C 15: 81,780,602 L554P probably damaging Het
Zfp352 C T 4: 90,224,777 P385S probably benign Het
Other mutations in Adgrg3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01096:Adgrg3 APN 8 95039593 missense possibly damaging 0.90
IGL01724:Adgrg3 APN 8 95039425 missense probably benign 0.04
IGL02111:Adgrg3 APN 8 95034999 missense probably damaging 0.96
IGL02142:Adgrg3 APN 8 95039855 missense probably damaging 1.00
IGL02577:Adgrg3 APN 8 95039927 missense probably damaging 0.99
IGL02940:Adgrg3 APN 8 95033456 missense possibly damaging 0.48
IGL03395:Adgrg3 APN 8 95035073 missense probably damaging 1.00
R0111:Adgrg3 UTSW 8 95035110 splice site probably benign
R0288:Adgrg3 UTSW 8 95039940 missense possibly damaging 0.92
R0403:Adgrg3 UTSW 8 95036922 missense probably benign 0.07
R1553:Adgrg3 UTSW 8 95040268 missense possibly damaging 0.90
R1667:Adgrg3 UTSW 8 95033373 nonsense probably null
R1686:Adgrg3 UTSW 8 95033369 missense probably benign 0.02
R1872:Adgrg3 UTSW 8 95033442 missense possibly damaging 0.87
R1882:Adgrg3 UTSW 8 95040315 missense probably benign 0.03
R1924:Adgrg3 UTSW 8 95035934 missense probably benign
R1998:Adgrg3 UTSW 8 95036668 missense probably damaging 1.00
R2090:Adgrg3 UTSW 8 95039930 missense possibly damaging 0.54
R2696:Adgrg3 UTSW 8 95021074 missense probably benign 0.01
R3846:Adgrg3 UTSW 8 95040421 missense probably benign 0.07
R4013:Adgrg3 UTSW 8 95035099 splice site probably benign
R4405:Adgrg3 UTSW 8 95036908 missense probably benign 0.15
R4622:Adgrg3 UTSW 8 95040525 missense probably damaging 1.00
R4878:Adgrg3 UTSW 8 95035086 missense possibly damaging 0.86
R5101:Adgrg3 UTSW 8 95036935 missense probably benign 0.00
R5309:Adgrg3 UTSW 8 95039864 missense probably benign 0.00
R5312:Adgrg3 UTSW 8 95039864 missense probably benign 0.00
R5353:Adgrg3 UTSW 8 95035928 missense probably damaging 0.99
R5820:Adgrg3 UTSW 8 95039593 missense possibly damaging 0.90
R6240:Adgrg3 UTSW 8 95039916 missense probably benign 0.23
R6272:Adgrg3 UTSW 8 95036261 missense noncoding transcript
R7110:Adgrg3 UTSW 8 95034963 missense possibly damaging 0.62
R8178:Adgrg3 UTSW 8 95035047 missense probably damaging 0.98
R8397:Adgrg3 UTSW 8 95040513 missense probably benign 0.01
X0017:Adgrg3 UTSW 8 95017770 start codon destroyed probably null 0.53
Predicted Primers PCR Primer
(F):5'- AGCCAAGGTAAGCACGAGTC -3'
(R):5'- GTAAGCATGGATCCAACAGCTCC -3'

Sequencing Primer
(F):5'- GGTAAGCACGAGTCCCCCAC -3'
(R):5'- CCAACTCCCCCTTAGGATGC -3'
Posted On2020-02-10