Incidental Mutation 'R7643:Trp53bp1'
ID628223
Institutional Source Beutler Lab
Gene Symbol Trp53bp1
Ensembl Gene ENSMUSG00000043909
Gene Nametransformation related protein 53 binding protein 1
Synonyms53BP1, p53BP1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7643 (G1)
Quality Score78.0075
Status Validated
Chromosome2
Chromosomal Location121193281-121271407 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) G to T at 121247814 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000114457 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110647] [ENSMUST00000110648] [ENSMUST00000129752] [ENSMUST00000131245]
Predicted Effect probably null
Transcript: ENSMUST00000110647
SMART Domains Protein: ENSMUSP00000106277
Gene: ENSMUSG00000043909

DomainStartEndE-ValueType
low complexity region 136 149 N/A INTRINSIC
low complexity region 158 169 N/A INTRINSIC
low complexity region 647 661 N/A INTRINSIC
low complexity region 1031 1042 N/A INTRINSIC
low complexity region 1099 1112 N/A INTRINSIC
low complexity region 1260 1272 N/A INTRINSIC
low complexity region 1290 1332 N/A INTRINSIC
Pfam:53-BP1_Tudor 1430 1551 2.5e-80 PFAM
low complexity region 1581 1601 N/A INTRINSIC
BRCT 1673 1785 7.13e-1 SMART
BRCT 1813 1901 1.03e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000110648
SMART Domains Protein: ENSMUSP00000106278
Gene: ENSMUSG00000043909

DomainStartEndE-ValueType
low complexity region 136 149 N/A INTRINSIC
low complexity region 158 169 N/A INTRINSIC
low complexity region 647 661 N/A INTRINSIC
low complexity region 1031 1042 N/A INTRINSIC
low complexity region 1099 1112 N/A INTRINSIC
low complexity region 1260 1272 N/A INTRINSIC
low complexity region 1290 1332 N/A INTRINSIC
low complexity region 1389 1409 N/A INTRINSIC
Pfam:53-BP1_Tudor 1480 1601 1.5e-80 PFAM
low complexity region 1631 1651 N/A INTRINSIC
BRCT 1723 1835 7.13e-1 SMART
BRCT 1863 1951 1.03e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129752
Predicted Effect probably null
Transcript: ENSMUST00000131245
SMART Domains Protein: ENSMUSP00000114457
Gene: ENSMUSG00000043909

DomainStartEndE-ValueType
low complexity region 136 149 N/A INTRINSIC
low complexity region 158 169 N/A INTRINSIC
low complexity region 647 661 N/A INTRINSIC
low complexity region 991 1002 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (64/64)
MGI Phenotype PHENOTYPE: Homozygous mutations in this gene result in growth retardation, immunodeficiency, thymic hypoplasia, and increased incidence of thymic lymphomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik A G 16: 38,827,863 Y295H probably benign Het
4931406C07Rik A G 9: 15,297,860 F46S probably damaging Het
Acaca T C 11: 84,338,356 Y1670H probably damaging Het
Acrbp G A 6: 125,053,832 R272Q possibly damaging Het
Adcy6 T A 15: 98,593,568 Q1050L probably benign Het
Amn1 C T 6: 149,185,031 M44I probably benign Het
Ankrd13b A G 11: 77,473,085 V395A probably benign Het
Ap3b2 T C 7: 81,477,072 K310R probably benign Het
Bnc2 T C 4: 84,506,574 D123G probably benign Het
Bst1 G A 5: 43,840,449 M263I probably benign Het
Ccdc7a C T 8: 128,889,811 G937E probably damaging Het
Cep290 A G 10: 100,537,553 M1232V probably benign Het
Cfhr1 A G 1: 139,553,585 Y186H possibly damaging Het
Dnah7c A T 1: 46,602,813 H1203L probably benign Het
Emc7 A G 2: 112,455,279 E71G probably benign Het
Exoc3l4 G A 12: 111,421,935 probably benign Het
Fam83c A G 2: 155,831,004 F278L possibly damaging Het
Gabpb2 C A 3: 95,200,225 V180L probably benign Het
Gbp2b G T 3: 142,603,609 Q160H probably benign Het
Gm19965 C G 1: 116,822,229 Q547E unknown Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Gon4l T A 3: 88,902,807 D1774E probably damaging Het
Gpr15 A C 16: 58,717,816 Y303* probably null Het
Greb1 T C 12: 16,711,996 D461G probably damaging Het
Gria4 T C 9: 4,793,950 N36S probably benign Het
Hacd1 T C 2: 14,044,791 I119V probably damaging Het
Ing5 T A 1: 93,812,433 D101E probably damaging Het
Irak4 T A 15: 94,558,828 N297K probably benign Het
Itga7 A G 10: 128,953,501 D971G probably benign Het
Klf5 A G 14: 99,313,178 E397G possibly damaging Het
Krtap29-1 C T 11: 99,978,198 G286S probably damaging Het
Lrp2bp A T 8: 46,020,527 probably null Het
March4 T G 1: 72,447,220 Q266H probably damaging Het
Med23 A G 10: 24,905,965 T1056A probably benign Het
Megf11 T C 9: 64,706,632 L1079P probably damaging Het
Mycbp2 G T 14: 103,346,265 L85I probably benign Het
Nlgn2 G T 11: 69,827,885 Q290K probably damaging Het
Nox4 A T 7: 87,323,754 E323V probably damaging Het
Nup93 T C 8: 94,286,619 probably null Het
Olfr298 C T 7: 86,489,568 probably null Het
Olfr558 C T 7: 102,709,538 T93I probably benign Het
Olfr977-ps1 T A 9: 39,974,821 M1L unknown Het
Otop3 T C 11: 115,339,648 L117P probably damaging Het
Pde6c C A 19: 38,141,421 Q260K probably damaging Het
Plb1 C T 5: 32,247,557 Q20* probably null Het
Qser1 A T 2: 104,786,977 Y1163* probably null Het
Rbm12 A T 2: 156,098,217 I45N unknown Het
Rictor T A 15: 6,769,269 Y332* probably null Het
Rpp14 C A 14: 8,090,325 S83* probably null Het
Sel1l3 C T 5: 53,123,162 probably null Het
Setd2 T C 9: 110,567,840 probably null Het
Spink5 A G 18: 44,010,252 T759A probably benign Het
Spon2 T A 5: 33,217,456 E2V probably benign Het
Tdrd1 T C 19: 56,837,708 S144P probably damaging Het
Tex15 A C 8: 33,575,120 Y1526S probably damaging Het
Tnfrsf21 T C 17: 43,037,916 S140P probably benign Het
Trav6-2 T A 14: 52,667,442 M11K probably benign Het
Ttn T C 2: 76,734,827 N28352S possibly damaging Het
Uckl1 T C 2: 181,573,106 I292V probably benign Het
Unc13b T A 4: 43,216,333 S211T probably benign Het
Zcchc4 T C 5: 52,808,293 I313T possibly damaging Het
Zfp106 C T 2: 120,512,734 R1811K probably benign Het
Zfp599 G T 9: 22,249,892 Q326K probably benign Het
Zscan4e A T 7: 11,309,525 M108K probably damaging Het
Other mutations in Trp53bp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Trp53bp1 APN 2 121256579 missense possibly damaging 0.69
IGL00690:Trp53bp1 APN 2 121235995 missense probably damaging 1.00
IGL00922:Trp53bp1 APN 2 121208482 missense probably damaging 0.96
IGL01475:Trp53bp1 APN 2 121270319 splice site probably null
IGL01639:Trp53bp1 APN 2 121202692 missense possibly damaging 0.51
IGL01662:Trp53bp1 APN 2 121236025 missense probably damaging 1.00
IGL01757:Trp53bp1 APN 2 121211304 missense probably damaging 0.99
IGL01829:Trp53bp1 APN 2 121215896 missense probably benign 0.39
IGL02247:Trp53bp1 APN 2 121236589 missense probably damaging 1.00
IGL02349:Trp53bp1 APN 2 121199074 missense probably damaging 1.00
IGL02391:Trp53bp1 APN 2 121202710 missense possibly damaging 0.67
chives UTSW 2 121251868 missense probably null 0.13
concur UTSW 2 121270319 splice site probably null
confirmation UTSW 2 121205113 critical splice acceptor site probably null
Infra UTSW 2 121247499 critical splice donor site probably null
lentil UTSW 2 121251868 missense probably null 0.13
lentil2 UTSW 2 121207887 missense probably damaging 1.00
Profundus UTSW 2 121207803 missense probably damaging 1.00
split_pea UTSW 2 121228606 nonsense probably null
verily UTSW 2 121211313 missense probably damaging 1.00
PIT1430001:Trp53bp1 UTSW 2 121271275 missense probably damaging 1.00
R0045:Trp53bp1 UTSW 2 121204497 missense probably benign
R0060:Trp53bp1 UTSW 2 121204525 missense probably damaging 1.00
R0060:Trp53bp1 UTSW 2 121204525 missense probably damaging 1.00
R0103:Trp53bp1 UTSW 2 121236759 missense possibly damaging 0.92
R0103:Trp53bp1 UTSW 2 121236759 missense possibly damaging 0.92
R0281:Trp53bp1 UTSW 2 121270237 missense probably damaging 1.00
R0386:Trp53bp1 UTSW 2 121204943 missense probably damaging 1.00
R0427:Trp53bp1 UTSW 2 121236017 missense probably damaging 1.00
R0505:Trp53bp1 UTSW 2 121269969 missense probably damaging 0.99
R0522:Trp53bp1 UTSW 2 121251868 missense probably null 0.13
R0523:Trp53bp1 UTSW 2 121251868 missense probably null 0.13
R0525:Trp53bp1 UTSW 2 121251868 missense probably null 0.13
R0543:Trp53bp1 UTSW 2 121251868 missense probably null 0.13
R0559:Trp53bp1 UTSW 2 121227801 missense probably damaging 1.00
R0573:Trp53bp1 UTSW 2 121228172 splice site probably benign
R0593:Trp53bp1 UTSW 2 121270528 missense possibly damaging 0.95
R0648:Trp53bp1 UTSW 2 121235707 missense probably benign 0.20
R0680:Trp53bp1 UTSW 2 121251868 missense probably null 0.13
R0732:Trp53bp1 UTSW 2 121248264 missense probably null 0.96
R0905:Trp53bp1 UTSW 2 121204318 splice site probably benign
R1377:Trp53bp1 UTSW 2 121270642 missense probably damaging 1.00
R1415:Trp53bp1 UTSW 2 121236184 missense probably damaging 1.00
R1725:Trp53bp1 UTSW 2 121252000 missense possibly damaging 0.46
R1971:Trp53bp1 UTSW 2 121205036 missense probably damaging 1.00
R2045:Trp53bp1 UTSW 2 121204483 missense probably benign
R2143:Trp53bp1 UTSW 2 121216064 missense probably benign 0.00
R2282:Trp53bp1 UTSW 2 121270273 nonsense probably null
R2296:Trp53bp1 UTSW 2 121209247 missense possibly damaging 0.96
R3106:Trp53bp1 UTSW 2 121236652 missense probably damaging 1.00
R3792:Trp53bp1 UTSW 2 121200329 missense probably damaging 1.00
R3793:Trp53bp1 UTSW 2 121200329 missense probably damaging 1.00
R3946:Trp53bp1 UTSW 2 121228626 missense probably damaging 0.99
R4001:Trp53bp1 UTSW 2 121205085 missense probably damaging 1.00
R4327:Trp53bp1 UTSW 2 121256650 missense probably damaging 1.00
R4585:Trp53bp1 UTSW 2 121207951 missense probably damaging 1.00
R4630:Trp53bp1 UTSW 2 121207887 missense probably damaging 1.00
R4744:Trp53bp1 UTSW 2 121211313 missense probably damaging 1.00
R4751:Trp53bp1 UTSW 2 121227809 missense probably damaging 1.00
R4754:Trp53bp1 UTSW 2 121207879 missense probably damaging 1.00
R4755:Trp53bp1 UTSW 2 121228606 nonsense probably null
R4850:Trp53bp1 UTSW 2 121205113 critical splice acceptor site probably null
R4870:Trp53bp1 UTSW 2 121256641 missense probably damaging 1.00
R4879:Trp53bp1 UTSW 2 121202603 missense probably damaging 0.99
R4924:Trp53bp1 UTSW 2 121221220 nonsense probably null
R4962:Trp53bp1 UTSW 2 121270546 missense probably benign 0.12
R5019:Trp53bp1 UTSW 2 121270319 splice site probably null
R5111:Trp53bp1 UTSW 2 121211387 missense probably damaging 0.99
R5149:Trp53bp1 UTSW 2 121216117 missense probably benign 0.00
R5252:Trp53bp1 UTSW 2 121243983 missense probably benign 0.40
R5533:Trp53bp1 UTSW 2 121207746 missense probably damaging 1.00
R5642:Trp53bp1 UTSW 2 121236662 missense probably benign 0.00
R5773:Trp53bp1 UTSW 2 121243914 missense probably damaging 1.00
R5819:Trp53bp1 UTSW 2 121208392 nonsense probably null
R5886:Trp53bp1 UTSW 2 121205021 missense probably damaging 1.00
R5908:Trp53bp1 UTSW 2 121236823 missense probably benign 0.06
R6012:Trp53bp1 UTSW 2 121256602 missense probably benign 0.07
R6351:Trp53bp1 UTSW 2 121269945 missense probably damaging 1.00
R6406:Trp53bp1 UTSW 2 121270612 missense probably damaging 0.99
R6575:Trp53bp1 UTSW 2 121228603 missense probably damaging 1.00
R6619:Trp53bp1 UTSW 2 121247499 critical splice donor site probably null
R6626:Trp53bp1 UTSW 2 121207803 missense probably damaging 1.00
R6754:Trp53bp1 UTSW 2 121270576 missense possibly damaging 0.83
R6765:Trp53bp1 UTSW 2 121209309 missense probably damaging 1.00
R6806:Trp53bp1 UTSW 2 121228666 missense probably damaging 0.99
R6860:Trp53bp1 UTSW 2 121199113 missense probably damaging 1.00
R6991:Trp53bp1 UTSW 2 121208040 missense probably damaging 1.00
R7278:Trp53bp1 UTSW 2 121199035 missense probably damaging 1.00
R7339:Trp53bp1 UTSW 2 121236469 missense probably benign 0.00
R7357:Trp53bp1 UTSW 2 121211300 missense probably damaging 1.00
R7477:Trp53bp1 UTSW 2 121236346 missense probably benign 0.34
R7577:Trp53bp1 UTSW 2 121236638 missense possibly damaging 0.65
R7728:Trp53bp1 UTSW 2 121207899 missense probably damaging 1.00
R7806:Trp53bp1 UTSW 2 121205061 missense probably damaging 0.99
RF046:Trp53bp1 UTSW 2 121216001 frame shift probably null
Z1088:Trp53bp1 UTSW 2 121253645 missense probably benign 0.04
Z1177:Trp53bp1 UTSW 2 121244060 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- GTTATTCACTGCAGCCAAGGG -3'
(R):5'- AGAAAATCGGTGCCTTGCGG -3'

Sequencing Primer
(F):5'- TTCACTGCAGCCAAGGGTTTAAC -3'
(R):5'- CCTTGCGGTTTATAAATGTGATGCAC -3'
Posted On2020-02-11