Incidental Mutation 'R7654:Tgfb1'
ID628229
Institutional Source Beutler Lab
Gene Symbol Tgfb1
Ensembl Gene ENSMUSG00000002603
Gene Nametransforming growth factor, beta 1
SynonymsTgfb, TGF-beta 1, TGFbeta1, Tgfb-1, TGF-beta1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.824) question?
Stock #R7654 (G1)
Quality Score73.0074
Status Validated
Chromosome7
Chromosomal Location25687002-25705077 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 25687695 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145950 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002678] [ENSMUST00000108403] [ENSMUST00000169009] [ENSMUST00000205325] [ENSMUST00000205658] [ENSMUST00000206913]
Predicted Effect probably benign
Transcript: ENSMUST00000002678
SMART Domains Protein: ENSMUSP00000002678
Gene: ENSMUSG00000002603

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
Pfam:TGFb_propeptide 29 261 3.2e-41 PFAM
TGFB 293 390 1.95e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108403
SMART Domains Protein: ENSMUSP00000104040
Gene: ENSMUSG00000063439

DomainStartEndE-ValueType
Pfam:B9-C2 4 164 5.1e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169009
Predicted Effect probably benign
Transcript: ENSMUST00000205325
Predicted Effect probably benign
Transcript: ENSMUST00000205658
Predicted Effect probably benign
Transcript: ENSMUST00000206913
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (76/76)
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate a latency-associated peptide (LAP) and a mature peptide, and is found in either a latent form composed of a mature peptide homodimer, a LAP homodimer, and a latent TGF-beta binding protein, or in an active form consisting solely of the mature peptide homodimer. The mature peptide may also form heterodimers with other TGF-beta family members. This encoded protein regulates cell proliferation, differentiation and growth, and can modulate expression and activation of other growth factors including interferon gamma and tumor necrosis factor alpha. Mice lacking a functional copy of this gene develop severe multifocal inflammatory disease, yolk sac defects and colon cancer. [provided by RefSeq, Aug 2016]
PHENOTYPE: Many homozygous null mutants die in utero by day 10.5 from yolk sac vasculature and hemopoietic defects. Survivors die by 5 weeks with wasting syndrome, excess inflammatory response and tissue necrosis. On BALB/c, mice develop necroinflammatory hepatitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 G A 19: 43,826,593 V1140M possibly damaging Het
Adamtsl3 A C 7: 82,574,494 E1161A probably benign Het
Adcy5 T C 16: 35,270,947 S587P probably damaging Het
Aebp2 T A 6: 140,653,748 probably null Het
Alb G C 5: 90,467,355 R242P probably damaging Het
Ankhd1 T C 18: 36,594,101 V423A probably damaging Het
Arid1b T A 17: 5,291,085 M888K possibly damaging Het
Asl C A 5: 130,018,390 R122S probably damaging Het
B3gntl1 T A 11: 121,651,613 D109V probably damaging Het
Cat G A 2: 103,460,364 P402S probably damaging Het
Ccdc141 A T 2: 77,042,478 Y787N probably benign Het
Ccdc78 T C 17: 25,790,111 Y405H probably damaging Het
Ces1f T G 8: 93,271,934 K145Q probably benign Het
Cfap65 A T 1: 74,933,144 C19S probably benign Het
CN725425 T A 15: 91,239,435 I118N probably benign Het
Ctc1 C T 11: 69,026,215 P312S probably damaging Het
Ctsa C T 2: 164,838,933 T442I probably benign Het
Cyp2b9 A G 7: 26,186,942 T131A possibly damaging Het
D630045J12Rik A G 6: 38,177,701 M1181T probably damaging Het
Dagla C G 19: 10,248,206 G865R probably benign Het
Dst A C 1: 34,228,977 K3153Q probably damaging Het
Dst A T 1: 34,228,978 K3153M probably damaging Het
Dync2h1 A T 9: 7,122,664 H2097Q probably damaging Het
Etnppl A G 3: 130,629,511 I286M probably benign Het
Flvcr1 A T 1: 191,011,605 M418K possibly damaging Het
Fuca1 T C 4: 135,929,921 S215P probably damaging Het
Gabrg1 T C 5: 70,778,161 K222E probably benign Het
Gdpd5 G A 7: 99,424,189 R26H probably damaging Het
Gnptab T A 10: 88,445,819 S1229R possibly damaging Het
Gpt A G 15: 76,698,330 E256G probably benign Het
Hif3a C T 7: 17,049,096 V261I probably damaging Het
Hmcn2 A G 2: 31,346,569 T375A probably benign Het
Hspa4 C A 11: 53,300,124 V15F probably damaging Het
Il18 A G 9: 50,579,401 N112S possibly damaging Het
Inpp4a A G 1: 37,374,098 probably null Het
Knop1 A G 7: 118,845,809 S525P unknown Het
Leo1 A T 9: 75,455,679 Y461F possibly damaging Het
Med1 C T 11: 98,169,363 V247I possibly damaging Het
Mpnd T G 17: 56,010,489 H159Q probably benign Het
Msl1 A G 11: 98,796,111 E94G possibly damaging Het
Mthfd2l A T 5: 90,946,806 I45F probably damaging Het
Neurl1b T A 17: 26,438,697 L203Q probably benign Het
Olfr1024 G T 2: 85,904,319 T245N possibly damaging Het
Otoa T G 7: 121,147,700 L896R probably damaging Het
Pcdhac2 T A 18: 37,145,023 V352E probably damaging Het
Pcsk5 T A 19: 17,456,804 K1400I possibly damaging Het
Pcx T A 19: 4,515,669 probably null Het
Pds5a A G 5: 65,618,981 V90A probably damaging Het
Pgam2 T C 11: 5,803,351 K113R probably null Het
Phkb G T 8: 85,940,887 R266L possibly damaging Het
Phtf2 A G 5: 20,782,461 S346P probably damaging Het
Pkd1l3 G A 8: 109,638,417 A1144T probably damaging Het
Plbd1 T C 6: 136,651,866 Y68C possibly damaging Het
Polk T C 13: 96,496,813 T241A probably benign Het
Ppfibp2 T A 7: 107,738,611 D635E probably damaging Het
Ppip5k1 G A 2: 121,348,559 R229W probably damaging Het
Ptpn20 A G 14: 33,638,324 D386G probably benign Het
Rab22a T C 2: 173,688,175 Y49H probably benign Het
Rab3gap1 A G 1: 127,909,915 D238G probably damaging Het
Rbp3 T C 14: 33,955,840 S582P probably benign Het
Rcbtb2 T C 14: 73,174,501 V410A probably benign Het
Sh3rf2 A G 18: 42,104,108 E232G probably damaging Het
Shroom1 T A 11: 53,466,908 V762E probably benign Het
Speer4f2 A T 5: 17,374,415 M71L Het
Sprr2b CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC 3: 92,317,519 probably benign Het
Tnik C T 3: 28,604,185 R540C probably damaging Het
Tti1 A T 2: 158,008,554 I255N probably benign Het
Ttn T C 2: 76,897,146 S5739G unknown Het
Umad1 G A 6: 8,426,995 V57M probably damaging Het
Usp30 T A 5: 114,102,445 I49N probably damaging Het
Usp7 G A 16: 8,702,043 T398I probably benign Het
Vmn2r65 A G 7: 84,941,053 Y552H probably damaging Het
Zfp616 A G 11: 74,083,187 N185S possibly damaging Het
Zfp804b T A 5: 6,769,458 T1202S probably damaging Het
Zfyve28 A T 5: 34,243,195 V53D probably damaging Het
Other mutations in Tgfb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Tgfb1 APN 7 25688017 missense probably damaging 1.00
IGL03028:Tgfb1 APN 7 25704196 missense probably damaging 1.00
PIT4377001:Tgfb1 UTSW 7 25696918 missense probably benign
R0004:Tgfb1 UTSW 7 25692366 splice site probably benign
R0048:Tgfb1 UTSW 7 25694354 splice site probably benign
R0048:Tgfb1 UTSW 7 25694354 splice site probably benign
R0470:Tgfb1 UTSW 7 25687930 unclassified probably benign
R1872:Tgfb1 UTSW 7 25692466 missense probably damaging 1.00
R2178:Tgfb1 UTSW 7 25704809 missense probably damaging 1.00
R4581:Tgfb1 UTSW 7 25697230 missense possibly damaging 0.81
R5484:Tgfb1 UTSW 7 25688149 missense probably benign 0.00
R5663:Tgfb1 UTSW 7 25694281 missense possibly damaging 0.93
R5781:Tgfb1 UTSW 7 25696960 missense probably benign 0.00
R6548:Tgfb1 UTSW 7 25696925 missense probably benign 0.01
R6727:Tgfb1 UTSW 7 25689162 unclassified probably benign
R7203:Tgfb1 UTSW 7 25692539 critical splice donor site probably null
R7449:Tgfb1 UTSW 7 25704838 missense probably damaging 1.00
Z1177:Tgfb1 UTSW 7 25688208 missense probably benign
Predicted Primers PCR Primer
(F):5'- GAAGACTTCACCCCAAAGCTGG -3'
(R):5'- CCATGTCGATGGTCTTGCAG -3'

Sequencing Primer
(F):5'- CAAAGCTGGGGCGCACC -3'
(R):5'- GTCAGCACTAGAAGCCACGG -3'
Posted On2020-02-11