Incidental Mutation 'R7638:Itga10'
ID 628238
Institutional Source Beutler Lab
Gene Symbol Itga10
Ensembl Gene ENSMUSG00000090210
Gene Name integrin, alpha 10
Synonyms
MMRRC Submission 045696-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.220) question?
Stock # R7638 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 96645584-96664519 bp(+) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) T to A at 96657391 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000112393 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029744] [ENSMUST00000119365] [ENSMUST00000137564]
AlphaFold E9Q6R1
Predicted Effect probably null
Transcript: ENSMUST00000029744
SMART Domains Protein: ENSMUSP00000029744
Gene: ENSMUSG00000090210

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Int_alpha 37 93 9.03e-3 SMART
VWA 165 355 9.6e-43 SMART
Int_alpha 427 481 2.01e0 SMART
Int_alpha 482 539 5.14e-7 SMART
Int_alpha 545 600 5.34e-14 SMART
Int_alpha 607 652 8.75e0 SMART
transmembrane domain 1123 1145 N/A INTRINSIC
low complexity region 1153 1166 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000119365
SMART Domains Protein: ENSMUSP00000112393
Gene: ENSMUSG00000090210

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Int_alpha 37 93 9.03e-3 SMART
VWA 165 355 9.6e-43 SMART
Int_alpha 427 481 2.01e0 SMART
Int_alpha 482 539 5.14e-7 SMART
Int_alpha 545 600 5.34e-14 SMART
Int_alpha 607 652 8.75e0 SMART
transmembrane domain 1122 1144 N/A INTRINSIC
low complexity region 1152 1165 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137564
SMART Domains Protein: ENSMUSP00000121011
Gene: ENSMUSG00000106447

DomainStartEndE-ValueType
Pfam:PEX11 1 172 4.5e-57 PFAM
low complexity region 186 204 N/A INTRINSIC
Int_alpha 222 278 9.03e-3 SMART
Blast:VWA 292 345 3e-7 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Integrins are integral transmembrane glycoproteins composed of noncovalently linked alpha and beta chains. They participate in cell adhesion as well as cell-surface mediated signalling. This gene encodes an integrin alpha chain and is expressed at high levels in chondrocytes, where it is transcriptionally regulated by AP-2epsilon and Ets-1. The protein encoded by this gene binds to collagen. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygous null mice display slightly shortened long bones and amild abnormalities in ephysiseal plate morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563D23Rik A G 16: 92,320,917 V161A probably damaging Het
Abo T G 2: 26,843,843 T115P probably damaging Het
Aggf1 G A 13: 95,356,413 R563* probably null Het
Amdhd1 A T 10: 93,534,498 Y159* probably null Het
BC027072 T C 17: 71,750,885 D599G probably damaging Het
C77080 T C 4: 129,221,941 T1022A probably benign Het
Camp T C 9: 109,848,393 E124G Het
Casq2 A G 3: 102,086,700 E21G possibly damaging Het
Cbln1 A T 8: 87,471,729 F116Y probably damaging Het
Cklf A T 8: 104,263,364 K143* probably null Het
Clca3a1 A G 3: 144,751,962 I387T probably damaging Het
Cndp1 T A 18: 84,636,049 D130V probably benign Het
Cyp4a12a T A 4: 115,327,473 M317K possibly damaging Het
D13Ertd608e A T 13: 119,842,688 probably null Het
Dmxl2 A T 9: 54,457,794 I138K unknown Het
Eapp A G 12: 54,673,723 S236P probably benign Het
Efnb3 T C 11: 69,557,220 H132R possibly damaging Het
Fbn2 A T 18: 58,105,136 N596K probably damaging Het
Fzd9 A G 5: 135,250,630 W134R probably damaging Het
Gga2 A G 7: 122,003,934 S180P probably damaging Het
Gm11639 T A 11: 105,036,799 M4798K probably benign Het
Gm30302 G T 13: 49,786,975 Q420K probably benign Het
Golga3 A G 5: 110,205,828 T911A probably benign Het
Gstm1 C T 3: 108,014,550 probably null Het
Heg1 A G 16: 33,727,497 T909A probably damaging Het
Herc2 T C 7: 56,157,438 S2455P probably benign Het
Herc2 C T 7: 56,220,525 R4349W probably damaging Het
Hivep2 T G 10: 14,143,851 M2122R possibly damaging Het
Kbtbd13 G T 9: 65,391,323 C110* probably null Het
Krt78 T C 15: 101,950,883 E293G probably damaging Het
Lgals3bp C T 11: 118,398,169 V110M possibly damaging Het
Lrp2 A G 2: 69,477,008 probably null Het
Lrrc14 A G 15: 76,713,973 D301G probably benign Het
Lrrc71 C A 3: 87,741,806 G352W probably damaging Het
Map3k9 A G 12: 81,724,732 V694A probably benign Het
Mboat2 T C 12: 24,939,326 S162P probably damaging Het
Megf11 C A 9: 64,679,253 N422K probably damaging Het
Miga1 C T 3: 152,276,687 S584N probably benign Het
Mindy2 A G 9: 70,616,859 Y403H probably damaging Het
Mmd C T 11: 90,276,757 A204V possibly damaging Het
Mta3 A T 17: 83,800,143 Y262F probably benign Het
Ncoa7 G A 10: 30,722,798 S43F probably benign Het
Nphp4 T C 4: 152,554,534 V874A probably benign Het
Nsd1 A G 13: 55,312,328 T2226A probably benign Het
Nt5dc1 T C 10: 34,314,796 H302R probably benign Het
Odc1 A G 12: 17,550,002 Y389C probably damaging Het
Olfr175-ps1 G A 16: 58,824,595 T38I probably damaging Het
Olfr551 A G 7: 102,587,918 I275T probably damaging Het
Olfr970 T G 9: 39,819,893 F85V probably damaging Het
Pcdhb10 A C 18: 37,412,312 Q147P probably benign Het
Pdcl2 A C 5: 76,317,828 C182G probably damaging Het
Pigv T C 4: 133,665,451 D136G possibly damaging Het
Pramel5 T C 4: 144,271,440 E411G possibly damaging Het
Prkce T C 17: 86,168,600 V3A probably benign Het
Pth1r T C 9: 110,722,393 N546S probably benign Het
Qrich2 C T 11: 116,455,322 V1559I probably benign Het
Rbm20 A C 19: 53,814,333 D424A possibly damaging Het
Rbm26 C T 14: 105,150,848 D393N probably damaging Het
Sf3b3 G A 8: 110,820,813 R728C probably damaging Het
Srcap A G 7: 127,538,748 N1090S probably benign Het
Syt4 A T 18: 31,443,822 S160T probably benign Het
Tfap2e C T 4: 126,721,934 V236M probably damaging Het
Thsd4 G A 9: 60,394,472 T180M probably damaging Het
Tlr4 T A 4: 66,840,206 M412K probably damaging Het
Tmem67 T A 4: 12,079,883 H136L probably benign Het
Tnpo2 T A 8: 85,044,415 I110N probably benign Het
Trav13d-3 A G 14: 53,033,413 M111V probably benign Het
Tubb3 A T 8: 123,421,161 S278C probably benign Het
Ugcg T A 4: 59,220,299 F364Y probably benign Het
Usp17lc T C 7: 103,418,499 S334P probably damaging Het
Vps13c A G 9: 67,945,509 D2357G probably damaging Het
Zfp157 T C 5: 138,455,910 Y125H probably benign Het
Zfp747 A T 7: 127,374,647 M117K probably benign Het
Znrd1 A C 17: 36,957,830 probably null Het
Zscan4c A T 7: 11,009,731 N419I possibly damaging Het
Other mutations in Itga10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01473:Itga10 APN 3 96647641 missense probably damaging 0.96
IGL01694:Itga10 APN 3 96652517 missense probably damaging 0.99
IGL01754:Itga10 APN 3 96656775 unclassified probably benign
IGL02527:Itga10 APN 3 96655624 unclassified probably benign
IGL02956:Itga10 APN 3 96655113 missense possibly damaging 0.46
IGL03371:Itga10 APN 3 96654788 missense possibly damaging 0.84
IGL03055:Itga10 UTSW 3 96650520 missense probably damaging 0.99
PIT4515001:Itga10 UTSW 3 96662632 missense probably damaging 0.99
R0153:Itga10 UTSW 3 96653700 missense probably benign 0.00
R0308:Itga10 UTSW 3 96651464 missense probably damaging 1.00
R0331:Itga10 UTSW 3 96652483 missense probably damaging 1.00
R0413:Itga10 UTSW 3 96649059 missense probably damaging 1.00
R0437:Itga10 UTSW 3 96649137 missense probably damaging 1.00
R0511:Itga10 UTSW 3 96658174 missense probably damaging 1.00
R0630:Itga10 UTSW 3 96656299 unclassified probably benign
R0844:Itga10 UTSW 3 96651738 splice site probably benign
R0849:Itga10 UTSW 3 96652530 missense possibly damaging 0.67
R0894:Itga10 UTSW 3 96653660 missense possibly damaging 0.69
R0919:Itga10 UTSW 3 96651738 splice site probably benign
R1027:Itga10 UTSW 3 96651738 splice site probably benign
R1341:Itga10 UTSW 3 96652495 missense probably damaging 1.00
R1350:Itga10 UTSW 3 96657477 missense probably benign 0.01
R1370:Itga10 UTSW 3 96651738 splice site probably benign
R1467:Itga10 UTSW 3 96652229 nonsense probably null
R1467:Itga10 UTSW 3 96652229 nonsense probably null
R1589:Itga10 UTSW 3 96651738 splice site probably benign
R1590:Itga10 UTSW 3 96651738 splice site probably benign
R1601:Itga10 UTSW 3 96653658 missense possibly damaging 0.82
R1659:Itga10 UTSW 3 96662977 missense probably damaging 0.96
R1665:Itga10 UTSW 3 96651738 splice site probably benign
R1667:Itga10 UTSW 3 96651738 splice site probably benign
R1686:Itga10 UTSW 3 96651825 missense probably damaging 0.97
R1972:Itga10 UTSW 3 96651738 splice site probably benign
R1976:Itga10 UTSW 3 96651738 splice site probably benign
R2020:Itga10 UTSW 3 96652490 missense probably damaging 1.00
R2040:Itga10 UTSW 3 96651738 splice site probably benign
R2044:Itga10 UTSW 3 96651738 splice site probably benign
R2044:Itga10 UTSW 3 96657690 missense probably benign
R2045:Itga10 UTSW 3 96651738 splice site probably benign
R2060:Itga10 UTSW 3 96654998 nonsense probably null
R2146:Itga10 UTSW 3 96651492 missense possibly damaging 0.59
R2146:Itga10 UTSW 3 96653723 missense probably damaging 1.00
R2170:Itga10 UTSW 3 96650457 missense probably damaging 1.00
R2893:Itga10 UTSW 3 96655100 missense probably benign 0.11
R2926:Itga10 UTSW 3 96652849 missense probably damaging 1.00
R3622:Itga10 UTSW 3 96651738 splice site probably benign
R3623:Itga10 UTSW 3 96651738 splice site probably benign
R4416:Itga10 UTSW 3 96658246 missense possibly damaging 0.58
R4633:Itga10 UTSW 3 96647704 missense possibly damaging 0.92
R5074:Itga10 UTSW 3 96652211 nonsense probably null
R5095:Itga10 UTSW 3 96648164 missense probably benign 0.21
R5495:Itga10 UTSW 3 96647371 missense possibly damaging 0.92
R5813:Itga10 UTSW 3 96652585 missense probably benign 0.38
R6114:Itga10 UTSW 3 96649035 missense probably damaging 1.00
R6172:Itga10 UTSW 3 96647437 missense probably benign 0.18
R6275:Itga10 UTSW 3 96658185 missense probably benign 0.36
R6298:Itga10 UTSW 3 96656762 missense probably benign 0.00
R6433:Itga10 UTSW 3 96658041 critical splice donor site probably null
R6841:Itga10 UTSW 3 96656714 missense probably damaging 1.00
R6909:Itga10 UTSW 3 96662599 missense probably benign 0.00
R6927:Itga10 UTSW 3 96656714 missense probably damaging 1.00
R7124:Itga10 UTSW 3 96651765 missense probably damaging 0.96
R7310:Itga10 UTSW 3 96648159 missense probably damaging 1.00
R7387:Itga10 UTSW 3 96652778 missense probably benign 0.11
R7464:Itga10 UTSW 3 96648155 missense probably damaging 1.00
R7624:Itga10 UTSW 3 96652953 missense probably benign
R7639:Itga10 UTSW 3 96649582 missense probably benign 0.36
R7893:Itga10 UTSW 3 96649612 missense probably damaging 1.00
R8297:Itga10 UTSW 3 96654800 missense probably damaging 1.00
R8753:Itga10 UTSW 3 96651155 missense probably damaging 1.00
R9526:Itga10 UTSW 3 96656957 missense probably damaging 1.00
X0064:Itga10 UTSW 3 96652936 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGCATCTTGTTGTCAGGTCC -3'
(R):5'- TCAGCCTCTCCAATCCATGAG -3'

Sequencing Primer
(F):5'- TCAGGTCCTGGGCATTAGAAC -3'
(R):5'- CCAATCCATGAGAGACTCTTCTG -3'
Posted On 2020-02-13