Mutagenetix > Incidental Mutation

Incidental Mutation 'R7638:Gstm1'

628239

Institutional Source

Beutler Lab

Gene Symbol

Gstm1

Ensembl Gene

ENSMUSG00000058135

Gene Name

glutathione S-transferase, mu 1

Synonyms

Gstb-1, Gstb1

MMRRC Submission

045696-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.136) question?

Stock #

R7638 (G1)

Quality Score

140.008

Status

Validated

Chromosome

Chromosomal Location

108012255-108017973 bp(-) (GRCm38)

Type of Mutation

splice site (203 bp from exon)

DNA Base Change (assembly)

C to T at 108014550 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000123481 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004140] [ENSMUST00000126593] [ENSMUST00000153314]

AlphaFold

P10649

Predicted Effect

probably null
Transcript: ENSMUST00000004140

SMART Domains

Protein: ENSMUSP00000004140
Gene: ENSMUSG00000058135

Domain	Start	End	E-Value	Type
Pfam:GST_N	3	82	1.3e-20	PFAM
Pfam:GST_C_3	40	190	5.2e-11	PFAM
Pfam:GST_C	104	192	3.7e-18	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000126593

SMART Domains

Protein: ENSMUSP00000118874
Gene: ENSMUSG00000058135

Domain	Start	End	E-Value	Type
Pfam:GST_N	3	82	8.3e-24	PFAM
Pfam:GST_C	104	201	6.7e-14	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000153314

SMART Domains

Protein: ENSMUSP00000123481
Gene: ENSMUSG00000058135

Domain	Start	End	E-Value	Type
Pfam:GST_N	1	23	1.7e-7	PFAM
Pfam:GST_C	45	168	1.2e-18	PFAM
Pfam:GST_C_3	92	166	8.3e-9	PFAM

Meta Mutation Damage Score

0.9756

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

100% (71/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cytosolic and membrane-bound forms of glutathione S-transferase are encoded by two distinct supergene families. At present, eight distinct classes of the soluble cytoplasmic mammalian glutathione S-transferases have been identified: alpha, kappa, mu, omega, pi, sigma, theta and zeta. This gene encodes a glutathione S-transferase that belongs to the mu class. The mu class of enzymes functions in the detoxification of electrophilic compounds, including carcinogens, therapeutic drugs, environmental toxins and products of oxidative stress, by conjugation with glutathione. The genes encoding the mu class of enzymes are organized in a gene cluster on chromosome 1p13.3 and are known to be highly polymorphic. These genetic variations can change an individual's susceptibility to carcinogens and toxins as well as affect the toxicity and efficacy of certain drugs. Diversification of these genes has occurred in regions encoding substrate-binding domains, as well as in tissue expression patterns, to accommodate an increasing number of foreign compounds. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for the deletion of this gene display a reduced ability to metabolize 1,2-dichloro-4-nitrobenzene. Mice homozygous for a different knock-out allele exhibit abnormal behavior, altered response to valproic acid, and increased serotonin and dopamine levels in the cerebellum. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930563D23Rik	A	G	16: 92,320,917	V161A	probably damaging	Het
Abo	T	G	2: 26,843,843	T115P	probably damaging	Het
Aggf1	G	A	13: 95,356,413	R563*	probably null	Het
Amdhd1	A	T	10: 93,534,498	Y159*	probably null	Het
BC027072	T	C	17: 71,750,885	D599G	probably damaging	Het
C77080	T	C	4: 129,221,941	T1022A	probably benign	Het
Camp	T	C	9: 109,848,393	E124G		Het
Casq2	A	G	3: 102,086,700	E21G	possibly damaging	Het
Cbln1	A	T	8: 87,471,729	F116Y	probably damaging	Het
Cklf	A	T	8: 104,263,364	K143*	probably null	Het
Clca3a1	A	G	3: 144,751,962	I387T	probably damaging	Het
Cndp1	T	A	18: 84,636,049	D130V	probably benign	Het
Cyp4a12a	T	A	4: 115,327,473	M317K	possibly damaging	Het
D13Ertd608e	A	T	13: 119,842,688		probably null	Het
Dmxl2	A	T	9: 54,457,794	I138K	unknown	Het
Eapp	A	G	12: 54,673,723	S236P	probably benign	Het
Efnb3	T	C	11: 69,557,220	H132R	possibly damaging	Het
Fbn2	A	T	18: 58,105,136	N596K	probably damaging	Het
Fzd9	A	G	5: 135,250,630	W134R	probably damaging	Het
Gga2	A	G	7: 122,003,934	S180P	probably damaging	Het
Gm11639	T	A	11: 105,036,799	M4798K	probably benign	Het
Gm30302	G	T	13: 49,786,975	Q420K	probably benign	Het
Golga3	A	G	5: 110,205,828	T911A	probably benign	Het
Heg1	A	G	16: 33,727,497	T909A	probably damaging	Het
Herc2	C	T	7: 56,220,525	R4349W	probably damaging	Het
Herc2	T	C	7: 56,157,438	S2455P	probably benign	Het
Hivep2	T	G	10: 14,143,851	M2122R	possibly damaging	Het
Itga10	T	A	3: 96,657,391		probably null	Het
Kbtbd13	G	T	9: 65,391,323	C110*	probably null	Het
Krt78	T	C	15: 101,950,883	E293G	probably damaging	Het
Lgals3bp	C	T	11: 118,398,169	V110M	possibly damaging	Het
Lrp2	A	G	2: 69,477,008		probably null	Het
Lrrc14	A	G	15: 76,713,973	D301G	probably benign	Het
Lrrc71	C	A	3: 87,741,806	G352W	probably damaging	Het
Map3k9	A	G	12: 81,724,732	V694A	probably benign	Het
Mboat2	T	C	12: 24,939,326	S162P	probably damaging	Het
Megf11	C	A	9: 64,679,253	N422K	probably damaging	Het
Miga1	C	T	3: 152,276,687	S584N	probably benign	Het
Mindy2	A	G	9: 70,616,859	Y403H	probably damaging	Het
Mmd	C	T	11: 90,276,757	A204V	possibly damaging	Het
Mta3	A	T	17: 83,800,143	Y262F	probably benign	Het
Ncoa7	G	A	10: 30,722,798	S43F	probably benign	Het
Nphp4	T	C	4: 152,554,534	V874A	probably benign	Het
Nsd1	A	G	13: 55,312,328	T2226A	probably benign	Het
Nt5dc1	T	C	10: 34,314,796	H302R	probably benign	Het
Odc1	A	G	12: 17,550,002	Y389C	probably damaging	Het
Olfr175-ps1	G	A	16: 58,824,595	T38I	probably damaging	Het
Olfr551	A	G	7: 102,587,918	I275T	probably damaging	Het
Olfr970	T	G	9: 39,819,893	F85V	probably damaging	Het
Pcdhb10	A	C	18: 37,412,312	Q147P	probably benign	Het
Pdcl2	A	C	5: 76,317,828	C182G	probably damaging	Het
Pigv	T	C	4: 133,665,451	D136G	possibly damaging	Het
Pramel5	T	C	4: 144,271,440	E411G	possibly damaging	Het
Prkce	T	C	17: 86,168,600	V3A	probably benign	Het
Pth1r	T	C	9: 110,722,393	N546S	probably benign	Het
Qrich2	C	T	11: 116,455,322	V1559I	probably benign	Het
Rbm20	A	C	19: 53,814,333	D424A	possibly damaging	Het
Rbm26	C	T	14: 105,150,848	D393N	probably damaging	Het
Sf3b3	G	A	8: 110,820,813	R728C	probably damaging	Het
Srcap	A	G	7: 127,538,748	N1090S	probably benign	Het
Syt4	A	T	18: 31,443,822	S160T	probably benign	Het
Tfap2e	C	T	4: 126,721,934	V236M	probably damaging	Het
Thsd4	G	A	9: 60,394,472	T180M	probably damaging	Het
Tlr4	T	A	4: 66,840,206	M412K	probably damaging	Het
Tmem67	T	A	4: 12,079,883	H136L	probably benign	Het
Tnpo2	T	A	8: 85,044,415	I110N	probably benign	Het
Trav13d-3	A	G	14: 53,033,413	M111V	probably benign	Het
Tubb3	A	T	8: 123,421,161	S278C	probably benign	Het
Ugcg	T	A	4: 59,220,299	F364Y	probably benign	Het
Usp17lc	T	C	7: 103,418,499	S334P	probably damaging	Het
Vps13c	A	G	9: 67,945,509	D2357G	probably damaging	Het
Zfp157	T	C	5: 138,455,910	Y125H	probably benign	Het
Zfp747	A	T	7: 127,374,647	M117K	probably benign	Het
Znrd1	A	C	17: 36,957,830		probably null	Het
Zscan4c	A	T	7: 11,009,731	N419I	possibly damaging	Het

Other mutations in Gstm1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R0335:Gstm1	UTSW	3	108012696	missense	possibly damaging	0.87
R0458:Gstm1	UTSW	3	108017363	missense	probably benign	0.01
R0907:Gstm1	UTSW	3	108017380	missense	probably damaging	1.00
R1069:Gstm1	UTSW	3	108012748	missense	probably damaging	1.00
R1180:Gstm1	UTSW	3	108014811	missense	probably damaging	1.00
R1181:Gstm1	UTSW	3	108014811	missense	probably damaging	1.00
R1998:Gstm1	UTSW	3	108014811	missense	probably damaging	1.00
R2000:Gstm1	UTSW	3	108014811	missense	probably damaging	1.00
R4483:Gstm1	UTSW	3	108016518	critical splice donor site	probably null
R4857:Gstm1	UTSW	3	108016408	missense	possibly damaging	0.67
R5192:Gstm1	UTSW	3	108014943	critical splice donor site	probably null
R5262:Gstm1	UTSW	3	108016363	missense	probably benign	0.01
R5356:Gstm1	UTSW	3	108012736	missense	probably benign	0.00
R5485:Gstm1	UTSW	3	108017404	missense	probably damaging	1.00
R6323:Gstm1	UTSW	3	108017747	missense	probably benign	0.44
R7165:Gstm1	UTSW	3	108016377	missense	probably benign
R7250:Gstm1	UTSW	3	108016393	missense	probably damaging	0.98
R9656:Gstm1	UTSW	3	108017756	missense	probably damaging	1.00
R9797:Gstm1	UTSW	3	108017764	missense	probably benign	0.10
X0023:Gstm1	UTSW	3	108012727	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTCTCAGCACTCAAGTCTGG -3'
(R):5'- TTTCTCGGGTCCATGATGC -3'

Sequencing Primer
(F):5'- GGCTATGTTACATTAGCTCTGC -3'
(R):5'- ATGATGCTTTCTAGTCCCAAGAC -3'

Posted On

2020-02-13