Incidental Mutation 'R7610:Syt17'
ID628246
Institutional Source Beutler Lab
Gene Symbol Syt17
Ensembl Gene ENSMUSG00000058420
Gene Namesynaptotagmin XVII
SynonymsBk
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7610 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location118380717-118448222 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 118434459 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145087 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081574] [ENSMUST00000081574] [ENSMUST00000203465] [ENSMUST00000203465] [ENSMUST00000203485] [ENSMUST00000203485] [ENSMUST00000203796] [ENSMUST00000203796] [ENSMUST00000207034]
Predicted Effect probably null
Transcript: ENSMUST00000081574
SMART Domains Protein: ENSMUSP00000080284
Gene: ENSMUSG00000058420

DomainStartEndE-ValueType
low complexity region 90 102 N/A INTRINSIC
low complexity region 103 118 N/A INTRINSIC
low complexity region 159 172 N/A INTRINSIC
C2 196 305 7.92e-19 SMART
low complexity region 315 328 N/A INTRINSIC
C2 333 448 2.8e-19 SMART
Predicted Effect probably null
Transcript: ENSMUST00000081574
SMART Domains Protein: ENSMUSP00000080284
Gene: ENSMUSG00000058420

DomainStartEndE-ValueType
low complexity region 90 102 N/A INTRINSIC
low complexity region 103 118 N/A INTRINSIC
low complexity region 159 172 N/A INTRINSIC
C2 196 305 7.92e-19 SMART
low complexity region 315 328 N/A INTRINSIC
C2 333 448 2.8e-19 SMART
Predicted Effect probably null
Transcript: ENSMUST00000203465
Predicted Effect probably null
Transcript: ENSMUST00000203465
Predicted Effect probably null
Transcript: ENSMUST00000203485
SMART Domains Protein: ENSMUSP00000144987
Gene: ENSMUSG00000058420

DomainStartEndE-ValueType
low complexity region 94 106 N/A INTRINSIC
low complexity region 107 122 N/A INTRINSIC
low complexity region 163 176 N/A INTRINSIC
C2 200 309 5.2e-21 SMART
low complexity region 319 332 N/A INTRINSIC
C2 337 419 3.1e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000203485
SMART Domains Protein: ENSMUSP00000144987
Gene: ENSMUSG00000058420

DomainStartEndE-ValueType
low complexity region 94 106 N/A INTRINSIC
low complexity region 107 122 N/A INTRINSIC
low complexity region 163 176 N/A INTRINSIC
C2 200 309 5.2e-21 SMART
low complexity region 319 332 N/A INTRINSIC
C2 337 419 3.1e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000203796
SMART Domains Protein: ENSMUSP00000145087
Gene: ENSMUSG00000058420

DomainStartEndE-ValueType
low complexity region 33 45 N/A INTRINSIC
low complexity region 46 61 N/A INTRINSIC
low complexity region 102 115 N/A INTRINSIC
C2 139 248 5.2e-21 SMART
low complexity region 258 271 N/A INTRINSIC
C2 276 391 1.9e-21 SMART
Predicted Effect probably null
Transcript: ENSMUST00000203796
SMART Domains Protein: ENSMUSP00000145087
Gene: ENSMUSG00000058420

DomainStartEndE-ValueType
low complexity region 33 45 N/A INTRINSIC
low complexity region 46 61 N/A INTRINSIC
low complexity region 102 115 N/A INTRINSIC
C2 139 248 5.2e-21 SMART
low complexity region 258 271 N/A INTRINSIC
C2 276 391 1.9e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207034
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933425L06Rik T A 13: 105,111,187 N338K probably damaging Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Adtrp A G 13: 41,816,194 F110L probably benign Het
Akap9 T G 5: 3,957,677 D230E possibly damaging Het
Alg11 G A 8: 22,065,131 R136H probably damaging Het
Ank3 A T 10: 69,986,422 N307I Het
Ankrd17 A G 5: 90,232,363 S2489P possibly damaging Het
Asf1b T G 8: 83,965,049 I43S probably damaging Het
Cdc37l1 G T 19: 29,007,732 G261W possibly damaging Het
Cpped1 C A 16: 11,894,878 probably null Het
Ctsk T C 3: 95,500,844 F4L probably benign Het
D130043K22Rik A T 13: 24,876,002 T619S probably benign Het
Ddx25 T A 9: 35,554,597 L109F possibly damaging Het
Dhrs9 C A 2: 69,392,947 A13D unknown Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Fam228a A G 12: 4,731,423 probably null Het
Fancm T C 12: 65,105,680 V970A probably damaging Het
Fcrls C A 3: 87,252,697 V417F probably damaging Het
Fig4 C A 10: 41,253,713 A504S probably damaging Het
Frmpd1 T C 4: 45,279,098 S608P probably damaging Het
Ggta1 C T 2: 35,414,218 probably null Het
Gm13084 A T 4: 143,812,866 M19K probably damaging Het
Grb10 T C 11: 11,943,955 K377R probably benign Het
Hivep3 CGG CG 4: 120,097,911 probably null Het
Klf14 A G 6: 30,958,070 S210P probably damaging Het
Marc2 A G 1: 184,819,286 Y318H probably benign Het
Mcm3ap A G 10: 76,496,720 probably null Het
Mgrn1 T C 16: 4,934,233 *533Q probably null Het
Notch1 A T 2: 26,478,179 H598Q probably benign Het
Ntng1 A G 3: 109,934,825 S211P probably damaging Het
Olfr1104 A G 2: 87,021,797 V249A possibly damaging Het
Olfr532 A T 7: 140,419,553 C73* probably null Het
Pgm5 A C 19: 24,834,756 N137K probably damaging Het
Plcb2 T A 2: 118,719,759 N172I possibly damaging Het
Rab11fip1 G A 8: 27,152,036 H912Y probably benign Het
Rgl1 A G 1: 152,552,620 V251A probably damaging Het
Rgs6 T C 12: 83,091,779 Y296H probably damaging Het
Rhpn1 A G 15: 75,712,396 T446A unknown Het
Rtn3 A G 19: 7,457,929 S233P probably damaging Het
Rwdd1 A C 10: 34,001,138 D203E probably benign Het
Samd9l A G 6: 3,376,754 V169A probably benign Het
Slfn5 T C 11: 82,961,484 L812P probably damaging Het
Smc1b T C 15: 85,070,820 D1077G possibly damaging Het
Snrnp48 A G 13: 38,209,961 R81G probably damaging Het
Tpsg1 G T 17: 25,373,210 G86V probably damaging Het
Ttc3 T C 16: 94,427,838 I757T probably benign Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Wdr54 C T 6: 83,152,858 V305M possibly damaging Het
Xirp2 C T 2: 67,525,962 T3689I possibly damaging Het
Zscan18 T C 7: 12,769,310 K774R probably damaging Het
Other mutations in Syt17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Syt17 APN 7 118434290 missense probably damaging 0.98
IGL01135:Syt17 APN 7 118382047 missense possibly damaging 0.92
IGL01331:Syt17 APN 7 118408166 missense probably damaging 0.99
IGL01610:Syt17 APN 7 118433993 missense possibly damaging 0.90
IGL01776:Syt17 APN 7 118409953 missense probably damaging 0.99
IGL02125:Syt17 APN 7 118409974 missense probably benign 0.01
IGL02819:Syt17 APN 7 118409920 splice site probably benign
H8562:Syt17 UTSW 7 118408069 missense probably benign 0.01
R0127:Syt17 UTSW 7 118409941 missense probably damaging 0.98
R0328:Syt17 UTSW 7 118381993 missense probably benign 0.28
R1789:Syt17 UTSW 7 118436838 missense probably benign 0.00
R1872:Syt17 UTSW 7 118408118 missense probably benign 0.00
R1878:Syt17 UTSW 7 118434245 missense probably benign 0.01
R1918:Syt17 UTSW 7 118433985 missense possibly damaging 0.54
R2133:Syt17 UTSW 7 118382047 missense possibly damaging 0.92
R3777:Syt17 UTSW 7 118433957 missense probably damaging 1.00
R4471:Syt17 UTSW 7 118436817 splice site probably null
R4472:Syt17 UTSW 7 118436817 splice site probably null
R4567:Syt17 UTSW 7 118434272 missense probably benign 0.06
R5211:Syt17 UTSW 7 118442403 missense probably benign 0.19
R5905:Syt17 UTSW 7 118436918 missense probably benign 0.10
R6054:Syt17 UTSW 7 118408133 missense possibly damaging 0.91
R6276:Syt17 UTSW 7 118434290 missense probably damaging 0.98
R6332:Syt17 UTSW 7 118434243 missense probably benign 0.00
R7022:Syt17 UTSW 7 118408019 missense probably benign 0.00
R7440:Syt17 UTSW 7 118381884 missense probably damaging 1.00
R7845:Syt17 UTSW 7 118409971 missense possibly damaging 0.79
R8294:Syt17 UTSW 7 118410005 missense probably damaging 0.99
R8296:Syt17 UTSW 7 118436846 missense probably damaging 0.97
R8429:Syt17 UTSW 7 118434341 missense probably benign
Z1177:Syt17 UTSW 7 118434223 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- GGACATGATCTCCTCGTCAG -3'
(R):5'- TCATGTAAAGGTTTTGAGCGTC -3'

Sequencing Primer
(F):5'- GTCAGTCAGAGAGTCTACGTCATC -3'
(R):5'- AAAGGTTTTGAGCGTCTGGGTG -3'
Posted On2020-02-18