Incidental Mutation 'R7610:Syt17'
ID 628246
Institutional Source Beutler Lab
Gene Symbol Syt17
Ensembl Gene ENSMUSG00000058420
Gene Name synaptotagmin XVII
Synonyms Bk
MMRRC Submission 045679-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7610 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 117979940-118047445 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to T at 118033682 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145087 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081574] [ENSMUST00000081574] [ENSMUST00000203465] [ENSMUST00000203465] [ENSMUST00000203485] [ENSMUST00000203485] [ENSMUST00000203796] [ENSMUST00000203796] [ENSMUST00000207034]
AlphaFold Q920M7
Predicted Effect probably null
Transcript: ENSMUST00000081574
SMART Domains Protein: ENSMUSP00000080284
Gene: ENSMUSG00000058420

DomainStartEndE-ValueType
low complexity region 90 102 N/A INTRINSIC
low complexity region 103 118 N/A INTRINSIC
low complexity region 159 172 N/A INTRINSIC
C2 196 305 7.92e-19 SMART
low complexity region 315 328 N/A INTRINSIC
C2 333 448 2.8e-19 SMART
Predicted Effect probably null
Transcript: ENSMUST00000081574
SMART Domains Protein: ENSMUSP00000080284
Gene: ENSMUSG00000058420

DomainStartEndE-ValueType
low complexity region 90 102 N/A INTRINSIC
low complexity region 103 118 N/A INTRINSIC
low complexity region 159 172 N/A INTRINSIC
C2 196 305 7.92e-19 SMART
low complexity region 315 328 N/A INTRINSIC
C2 333 448 2.8e-19 SMART
Predicted Effect probably null
Transcript: ENSMUST00000203465
Predicted Effect probably null
Transcript: ENSMUST00000203465
Predicted Effect probably null
Transcript: ENSMUST00000203485
SMART Domains Protein: ENSMUSP00000144987
Gene: ENSMUSG00000058420

DomainStartEndE-ValueType
low complexity region 94 106 N/A INTRINSIC
low complexity region 107 122 N/A INTRINSIC
low complexity region 163 176 N/A INTRINSIC
C2 200 309 5.2e-21 SMART
low complexity region 319 332 N/A INTRINSIC
C2 337 419 3.1e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000203485
SMART Domains Protein: ENSMUSP00000144987
Gene: ENSMUSG00000058420

DomainStartEndE-ValueType
low complexity region 94 106 N/A INTRINSIC
low complexity region 107 122 N/A INTRINSIC
low complexity region 163 176 N/A INTRINSIC
C2 200 309 5.2e-21 SMART
low complexity region 319 332 N/A INTRINSIC
C2 337 419 3.1e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000203796
SMART Domains Protein: ENSMUSP00000145087
Gene: ENSMUSG00000058420

DomainStartEndE-ValueType
low complexity region 33 45 N/A INTRINSIC
low complexity region 46 61 N/A INTRINSIC
low complexity region 102 115 N/A INTRINSIC
C2 139 248 5.2e-21 SMART
low complexity region 258 271 N/A INTRINSIC
C2 276 391 1.9e-21 SMART
Predicted Effect probably null
Transcript: ENSMUST00000203796
SMART Domains Protein: ENSMUSP00000145087
Gene: ENSMUSG00000058420

DomainStartEndE-ValueType
low complexity region 33 45 N/A INTRINSIC
low complexity region 46 61 N/A INTRINSIC
low complexity region 102 115 N/A INTRINSIC
C2 139 248 5.2e-21 SMART
low complexity region 258 271 N/A INTRINSIC
C2 276 391 1.9e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207034
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta2 G A 19: 34,229,931 (GRCm39) T8I probably benign Het
Adtrp A G 13: 41,969,670 (GRCm39) F110L probably benign Het
Akap9 T G 5: 4,007,677 (GRCm39) D230E possibly damaging Het
Alg11 G A 8: 22,555,147 (GRCm39) R136H probably damaging Het
Ank3 A T 10: 69,822,252 (GRCm39) N307I Het
Ankrd17 A G 5: 90,380,222 (GRCm39) S2489P possibly damaging Het
Asf1b T G 8: 84,691,678 (GRCm39) I43S probably damaging Het
Cdc37l1 G T 19: 28,985,132 (GRCm39) G261W possibly damaging Het
Cpped1 C A 16: 11,712,742 (GRCm39) probably null Het
Ctsk T C 3: 95,408,155 (GRCm39) F4L probably benign Het
D130043K22Rik A T 13: 25,059,985 (GRCm39) T619S probably benign Het
Ddx25 T A 9: 35,465,893 (GRCm39) L109F possibly damaging Het
Dhrs9 C A 2: 69,223,291 (GRCm39) A13D unknown Het
Epha7 C T 4: 28,871,937 (GRCm39) S422L probably benign Het
Fam228a A G 12: 4,781,423 (GRCm39) probably null Het
Fancm T C 12: 65,152,454 (GRCm39) V970A probably damaging Het
Fcrl2 C A 3: 87,160,004 (GRCm39) V417F probably damaging Het
Fig4 C A 10: 41,129,709 (GRCm39) A504S probably damaging Het
Frmpd1 T C 4: 45,279,098 (GRCm39) S608P probably damaging Het
Ggta1 C T 2: 35,304,230 (GRCm39) probably null Het
Grb10 T C 11: 11,893,955 (GRCm39) K377R probably benign Het
Hivep3 CGG CG 4: 119,955,108 (GRCm39) 1141 probably null Het
Klf14 A G 6: 30,935,005 (GRCm39) S210P probably damaging Het
Mcm3ap A G 10: 76,332,554 (GRCm39) probably null Het
Mgrn1 T C 16: 4,752,097 (GRCm39) *533Q probably null Het
Mtarc2 A G 1: 184,551,483 (GRCm39) Y318H probably benign Het
Notch1 A T 2: 26,368,191 (GRCm39) H598Q probably benign Het
Nt5el T A 13: 105,247,695 (GRCm39) N338K probably damaging Het
Ntng1 A G 3: 109,842,141 (GRCm39) S211P probably damaging Het
Or13a21 A T 7: 139,999,466 (GRCm39) C73* probably null Het
Or8i2 A G 2: 86,852,141 (GRCm39) V249A possibly damaging Het
Pgm5 A C 19: 24,812,120 (GRCm39) N137K probably damaging Het
Plcb2 T A 2: 118,550,240 (GRCm39) N172I possibly damaging Het
Pramel26 A T 4: 143,539,436 (GRCm39) M19K probably damaging Het
Rab11fip1 G A 8: 27,642,064 (GRCm39) H912Y probably benign Het
Rgl1 A G 1: 152,428,371 (GRCm39) V251A probably damaging Het
Rgs6 T C 12: 83,138,553 (GRCm39) Y296H probably damaging Het
Rhpn1 A G 15: 75,584,245 (GRCm39) T446A unknown Het
Rtn3 A G 19: 7,435,294 (GRCm39) S233P probably damaging Het
Rwdd1 A C 10: 33,877,134 (GRCm39) D203E probably benign Het
Samd9l A G 6: 3,376,754 (GRCm39) V169A probably benign Het
Slfn5 T C 11: 82,852,310 (GRCm39) L812P probably damaging Het
Smc1b T C 15: 84,955,021 (GRCm39) D1077G possibly damaging Het
Snrnp48 A G 13: 38,393,937 (GRCm39) R81G probably damaging Het
Tpsg1 G T 17: 25,592,184 (GRCm39) G86V probably damaging Het
Ttc3 T C 16: 94,228,697 (GRCm39) I757T probably benign Het
Urb1 CACTTAC CAC 16: 90,569,461 (GRCm39) probably benign Het
Wdr54 C T 6: 83,129,839 (GRCm39) V305M possibly damaging Het
Xirp2 C T 2: 67,356,306 (GRCm39) T3689I possibly damaging Het
Zscan18 T C 7: 12,503,237 (GRCm39) K774R probably damaging Het
Other mutations in Syt17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Syt17 APN 7 118,033,513 (GRCm39) missense probably damaging 0.98
IGL01135:Syt17 APN 7 117,981,270 (GRCm39) missense possibly damaging 0.92
IGL01331:Syt17 APN 7 118,007,389 (GRCm39) missense probably damaging 0.99
IGL01610:Syt17 APN 7 118,033,216 (GRCm39) missense possibly damaging 0.90
IGL01776:Syt17 APN 7 118,009,176 (GRCm39) missense probably damaging 0.99
IGL02125:Syt17 APN 7 118,009,197 (GRCm39) missense probably benign 0.01
IGL02819:Syt17 APN 7 118,009,143 (GRCm39) splice site probably benign
H8562:Syt17 UTSW 7 118,007,292 (GRCm39) missense probably benign 0.01
R0127:Syt17 UTSW 7 118,009,164 (GRCm39) missense probably damaging 0.98
R0328:Syt17 UTSW 7 117,981,216 (GRCm39) missense probably benign 0.28
R1789:Syt17 UTSW 7 118,036,061 (GRCm39) missense probably benign 0.00
R1872:Syt17 UTSW 7 118,007,341 (GRCm39) missense probably benign 0.00
R1878:Syt17 UTSW 7 118,033,468 (GRCm39) missense probably benign 0.01
R1918:Syt17 UTSW 7 118,033,208 (GRCm39) missense possibly damaging 0.54
R2133:Syt17 UTSW 7 117,981,270 (GRCm39) missense possibly damaging 0.92
R3777:Syt17 UTSW 7 118,033,180 (GRCm39) missense probably damaging 1.00
R4471:Syt17 UTSW 7 118,036,040 (GRCm39) splice site probably null
R4472:Syt17 UTSW 7 118,036,040 (GRCm39) splice site probably null
R4567:Syt17 UTSW 7 118,033,495 (GRCm39) missense probably benign 0.06
R5211:Syt17 UTSW 7 118,041,626 (GRCm39) missense probably benign 0.19
R5905:Syt17 UTSW 7 118,036,141 (GRCm39) missense probably benign 0.10
R6054:Syt17 UTSW 7 118,007,356 (GRCm39) missense possibly damaging 0.91
R6276:Syt17 UTSW 7 118,033,513 (GRCm39) missense probably damaging 0.98
R6332:Syt17 UTSW 7 118,033,466 (GRCm39) missense probably benign 0.00
R7022:Syt17 UTSW 7 118,007,242 (GRCm39) missense probably benign 0.00
R7440:Syt17 UTSW 7 117,981,107 (GRCm39) missense probably damaging 1.00
R7845:Syt17 UTSW 7 118,009,194 (GRCm39) missense possibly damaging 0.79
R8294:Syt17 UTSW 7 118,009,228 (GRCm39) missense probably damaging 0.99
R8296:Syt17 UTSW 7 118,036,069 (GRCm39) missense probably damaging 0.97
R8429:Syt17 UTSW 7 118,033,564 (GRCm39) missense probably benign
R8949:Syt17 UTSW 7 118,033,054 (GRCm39) critical splice donor site probably null
R9278:Syt17 UTSW 7 118,033,480 (GRCm39) missense probably damaging 1.00
R9622:Syt17 UTSW 7 118,036,191 (GRCm39) missense probably benign
R9629:Syt17 UTSW 7 118,007,379 (GRCm39) missense probably damaging 0.96
Z1177:Syt17 UTSW 7 118,033,446 (GRCm39) missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- GGACATGATCTCCTCGTCAG -3'
(R):5'- TCATGTAAAGGTTTTGAGCGTC -3'

Sequencing Primer
(F):5'- GTCAGTCAGAGAGTCTACGTCATC -3'
(R):5'- AAAGGTTTTGAGCGTCTGGGTG -3'
Posted On 2020-02-18