Incidental Mutation 'R7610:Rhpn1'
ID628248
Institutional Source Beutler Lab
Gene Symbol Rhpn1
Ensembl Gene ENSMUSG00000022580
Gene Namerhophilin, Rho GTPase binding protein 1
SynonymsGrbp, Rhophilin
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7610 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location75704280-75715485 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 75712396 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 446 (T446A)
Ref Sequence ENSEMBL: ENSMUSP00000116837 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023244] [ENSMUST00000121137] [ENSMUST00000149407]
Predicted Effect silent
Transcript: ENSMUST00000023244
SMART Domains Protein: ENSMUSP00000023244
Gene: ENSMUSG00000022580

DomainStartEndE-ValueType
Hr1 42 105 1.98e-17 SMART
BRO1 115 498 4.31e-147 SMART
PDZ 508 578 9.27e-19 SMART
Predicted Effect silent
Transcript: ENSMUST00000121137
SMART Domains Protein: ENSMUSP00000113042
Gene: ENSMUSG00000022580

DomainStartEndE-ValueType
Hr1 42 105 1.98e-17 SMART
BRO1 115 516 1.64e-161 SMART
PDZ 526 596 9.27e-19 SMART
Predicted Effect unknown
Transcript: ENSMUST00000149407
AA Change: T446A
SMART Domains Protein: ENSMUSP00000116837
Gene: ENSMUSG00000022580
AA Change: T446A

DomainStartEndE-ValueType
Hr1 42 105 1.98e-17 SMART
BRO1 115 449 7.17e-103 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933425L06Rik T A 13: 105,111,187 N338K probably damaging Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Adtrp A G 13: 41,816,194 F110L probably benign Het
Akap9 T G 5: 3,957,677 D230E possibly damaging Het
Alg11 G A 8: 22,065,131 R136H probably damaging Het
Ank3 A T 10: 69,986,422 N307I Het
Ankrd17 A G 5: 90,232,363 S2489P possibly damaging Het
Asf1b T G 8: 83,965,049 I43S probably damaging Het
Cdc37l1 G T 19: 29,007,732 G261W possibly damaging Het
Cpped1 C A 16: 11,894,878 probably null Het
Ctsk T C 3: 95,500,844 F4L probably benign Het
D130043K22Rik A T 13: 24,876,002 T619S probably benign Het
Ddx25 T A 9: 35,554,597 L109F possibly damaging Het
Dhrs9 C A 2: 69,392,947 A13D unknown Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Fam228a A G 12: 4,731,423 probably null Het
Fancm T C 12: 65,105,680 V970A probably damaging Het
Fcrls C A 3: 87,252,697 V417F probably damaging Het
Fig4 C A 10: 41,253,713 A504S probably damaging Het
Frmpd1 T C 4: 45,279,098 S608P probably damaging Het
Ggta1 C T 2: 35,414,218 probably null Het
Gm13084 A T 4: 143,812,866 M19K probably damaging Het
Grb10 T C 11: 11,943,955 K377R probably benign Het
Hivep3 CGG CG 4: 120,097,911 probably null Het
Klf14 A G 6: 30,958,070 S210P probably damaging Het
Marc2 A G 1: 184,819,286 Y318H probably benign Het
Mcm3ap A G 10: 76,496,720 probably null Het
Mgrn1 T C 16: 4,934,233 *533Q probably null Het
Notch1 A T 2: 26,478,179 H598Q probably benign Het
Ntng1 A G 3: 109,934,825 S211P probably damaging Het
Olfr1104 A G 2: 87,021,797 V249A possibly damaging Het
Olfr532 A T 7: 140,419,553 C73* probably null Het
Pgm5 A C 19: 24,834,756 N137K probably damaging Het
Plcb2 T A 2: 118,719,759 N172I possibly damaging Het
Rab11fip1 G A 8: 27,152,036 H912Y probably benign Het
Rgl1 A G 1: 152,552,620 V251A probably damaging Het
Rgs6 T C 12: 83,091,779 Y296H probably damaging Het
Rtn3 A G 19: 7,457,929 S233P probably damaging Het
Rwdd1 A C 10: 34,001,138 D203E probably benign Het
Samd9l A G 6: 3,376,754 V169A probably benign Het
Slfn5 T C 11: 82,961,484 L812P probably damaging Het
Smc1b T C 15: 85,070,820 D1077G possibly damaging Het
Snrnp48 A G 13: 38,209,961 R81G probably damaging Het
Syt17 A T 7: 118,434,459 probably null Het
Tpsg1 G T 17: 25,373,210 G86V probably damaging Het
Ttc3 T C 16: 94,427,838 I757T probably benign Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Wdr54 C T 6: 83,152,858 V305M possibly damaging Het
Xirp2 C T 2: 67,525,962 T3689I possibly damaging Het
Zscan18 T C 7: 12,769,310 K774R probably damaging Het
Other mutations in Rhpn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Rhpn1 APN 15 75711886 missense probably damaging 0.99
IGL02211:Rhpn1 APN 15 75711056 missense possibly damaging 0.94
R0049:Rhpn1 UTSW 15 75709239 missense possibly damaging 0.73
R0049:Rhpn1 UTSW 15 75709239 missense possibly damaging 0.73
R0240:Rhpn1 UTSW 15 75714122 missense probably benign 0.05
R0240:Rhpn1 UTSW 15 75714122 missense probably benign 0.05
R0324:Rhpn1 UTSW 15 75711588 missense probably damaging 0.99
R0426:Rhpn1 UTSW 15 75711872 missense possibly damaging 0.71
R0453:Rhpn1 UTSW 15 75713579 missense possibly damaging 0.93
R0893:Rhpn1 UTSW 15 75711654 missense probably damaging 1.00
R1051:Rhpn1 UTSW 15 75712392 missense probably damaging 0.99
R1571:Rhpn1 UTSW 15 75714118 missense possibly damaging 0.93
R1906:Rhpn1 UTSW 15 75711824 missense probably benign 0.02
R1907:Rhpn1 UTSW 15 75711824 missense probably benign 0.02
R2110:Rhpn1 UTSW 15 75713234 missense probably damaging 1.00
R2153:Rhpn1 UTSW 15 75704394 start codon destroyed probably null 0.00
R3943:Rhpn1 UTSW 15 75711806 missense probably damaging 0.97
R4030:Rhpn1 UTSW 15 75710557 missense probably damaging 1.00
R4552:Rhpn1 UTSW 15 75714119 missense probably benign 0.00
R5015:Rhpn1 UTSW 15 75708241 missense probably damaging 1.00
R5103:Rhpn1 UTSW 15 75714215 missense possibly damaging 0.83
R5121:Rhpn1 UTSW 15 75709260 missense probably damaging 1.00
R5337:Rhpn1 UTSW 15 75708205 missense probably benign
R7324:Rhpn1 UTSW 15 75704397 missense possibly damaging 0.89
R7596:Rhpn1 UTSW 15 75712313 missense probably benign 0.00
R7808:Rhpn1 UTSW 15 75713450 missense probably benign 0.09
R8103:Rhpn1 UTSW 15 75709266 missense probably null 1.00
R8128:Rhpn1 UTSW 15 75711183 critical splice donor site probably null
Z1177:Rhpn1 UTSW 15 75711602 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCCAGCTTGTATGCATGATG -3'
(R):5'- GGCTGATATCCTCACAGTCTCC -3'

Sequencing Primer
(F):5'- CATGGTGCGTGCGTGCG -3'
(R):5'- TGCTAGGCTGGGATCTATAGACAC -3'
Posted On2020-02-18