Incidental Mutation 'R7610:Cpped1'
ID628249
Institutional Source Beutler Lab
Gene Symbol Cpped1
Ensembl Gene ENSMUSG00000065979
Gene Namecalcineurin-like phosphoesterase domain containing 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R7610 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location11803721-11909445 bp(-) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) C to A at 11894878 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119989 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073371] [ENSMUST00000096272] [ENSMUST00000121750] [ENSMUST00000127972]
Predicted Effect probably benign
Transcript: ENSMUST00000073371
SMART Domains Protein: ENSMUSP00000089104
Gene: ENSMUSG00000065979

DomainStartEndE-ValueType
low complexity region 97 109 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000096272
SMART Domains Protein: ENSMUSP00000093992
Gene: ENSMUSG00000065979

DomainStartEndE-ValueType
Pfam:Metallophos 33 250 4.6e-14 PFAM
Pfam:Metallophos_2 63 285 6e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121750
SMART Domains Protein: ENSMUSP00000112587
Gene: ENSMUSG00000065979

DomainStartEndE-ValueType
Pfam:Metallophos 25 236 1e-14 PFAM
Pfam:Metallophos_2 45 271 6.8e-12 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000127972
SMART Domains Protein: ENSMUSP00000119989
Gene: ENSMUSG00000065979

DomainStartEndE-ValueType
Pfam:Metallophos 57 239 2e-10 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933425L06Rik T A 13: 105,111,187 N338K probably damaging Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Adtrp A G 13: 41,816,194 F110L probably benign Het
Akap9 T G 5: 3,957,677 D230E possibly damaging Het
Alg11 G A 8: 22,065,131 R136H probably damaging Het
Ank3 A T 10: 69,986,422 N307I Het
Ankrd17 A G 5: 90,232,363 S2489P possibly damaging Het
Asf1b T G 8: 83,965,049 I43S probably damaging Het
Cdc37l1 G T 19: 29,007,732 G261W possibly damaging Het
Ctsk T C 3: 95,500,844 F4L probably benign Het
D130043K22Rik A T 13: 24,876,002 T619S probably benign Het
Ddx25 T A 9: 35,554,597 L109F possibly damaging Het
Dhrs9 C A 2: 69,392,947 A13D unknown Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Fam228a A G 12: 4,731,423 probably null Het
Fancm T C 12: 65,105,680 V970A probably damaging Het
Fcrls C A 3: 87,252,697 V417F probably damaging Het
Fig4 C A 10: 41,253,713 A504S probably damaging Het
Frmpd1 T C 4: 45,279,098 S608P probably damaging Het
Ggta1 C T 2: 35,414,218 probably null Het
Gm13084 A T 4: 143,812,866 M19K probably damaging Het
Grb10 T C 11: 11,943,955 K377R probably benign Het
Hivep3 CGG CG 4: 120,097,911 probably null Het
Klf14 A G 6: 30,958,070 S210P probably damaging Het
Marc2 A G 1: 184,819,286 Y318H probably benign Het
Mcm3ap A G 10: 76,496,720 probably null Het
Mgrn1 T C 16: 4,934,233 *533Q probably null Het
Notch1 A T 2: 26,478,179 H598Q probably benign Het
Ntng1 A G 3: 109,934,825 S211P probably damaging Het
Olfr1104 A G 2: 87,021,797 V249A possibly damaging Het
Olfr532 A T 7: 140,419,553 C73* probably null Het
Pgm5 A C 19: 24,834,756 N137K probably damaging Het
Plcb2 T A 2: 118,719,759 N172I possibly damaging Het
Rab11fip1 G A 8: 27,152,036 H912Y probably benign Het
Rgl1 A G 1: 152,552,620 V251A probably damaging Het
Rgs6 T C 12: 83,091,779 Y296H probably damaging Het
Rhpn1 A G 15: 75,712,396 T446A unknown Het
Rtn3 A G 19: 7,457,929 S233P probably damaging Het
Rwdd1 A C 10: 34,001,138 D203E probably benign Het
Samd9l A G 6: 3,376,754 V169A probably benign Het
Slfn5 T C 11: 82,961,484 L812P probably damaging Het
Smc1b T C 15: 85,070,820 D1077G possibly damaging Het
Snrnp48 A G 13: 38,209,961 R81G probably damaging Het
Syt17 A T 7: 118,434,459 probably null Het
Tpsg1 G T 17: 25,373,210 G86V probably damaging Het
Ttc3 T C 16: 94,427,838 I757T probably benign Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Wdr54 C T 6: 83,152,858 V305M possibly damaging Het
Xirp2 C T 2: 67,525,962 T3689I possibly damaging Het
Zscan18 T C 7: 12,769,310 K774R probably damaging Het
Other mutations in Cpped1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02221:Cpped1 APN 16 11828528 missense probably damaging 1.00
IGL02448:Cpped1 APN 16 11805389 missense probably benign 0.30
IGL03048:Cpped1 UTSW 16 11828475 missense probably benign 0.23
R0725:Cpped1 UTSW 16 11828450 missense probably damaging 0.97
R2084:Cpped1 UTSW 16 11828501 missense probably damaging 1.00
R2276:Cpped1 UTSW 16 11894881 critical splice donor site probably null
R3702:Cpped1 UTSW 16 11828440 missense probably damaging 1.00
R4321:Cpped1 UTSW 16 11887746 missense probably benign 0.35
R4407:Cpped1 UTSW 16 11805421 missense probably damaging 0.96
R4421:Cpped1 UTSW 16 11805357 makesense probably null
R4672:Cpped1 UTSW 16 11805374 nonsense probably null
R4704:Cpped1 UTSW 16 11885629 intron probably benign
R4928:Cpped1 UTSW 16 11828279 missense probably damaging 1.00
R5647:Cpped1 UTSW 16 11828146 unclassified probably benign
R7260:Cpped1 UTSW 16 11828463 missense possibly damaging 0.90
R8008:Cpped1 UTSW 16 11828396 missense probably damaging 1.00
X0017:Cpped1 UTSW 16 11828292 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGTTAAGCCCCTTTATTTTGGCC -3'
(R):5'- GCAGTGACTGTGGGTATCAC -3'

Sequencing Primer
(F):5'- TATTTTGGCCCATCCACAGGAAG -3'
(R):5'- TGGGTATCACAGACGACCG -3'
Posted On2020-02-18