Incidental Mutation 'R0715:Sh3pxd2b'
ID62825
Institutional Source Beutler Lab
Gene Symbol Sh3pxd2b
Ensembl Gene ENSMUSG00000040711
Gene NameSH3 and PX domains 2B
SynonymsG431001E03Rik, Fad49, Tsk4
MMRRC Submission 038898-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.290) question?
Stock #R0715 (G1)
Quality Score87
Status Validated
Chromosome11
Chromosomal Location32347820-32428173 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32423341 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 836 (E836G)
Ref Sequence ENSEMBL: ENSMUSP00000044276 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038753]
Predicted Effect possibly damaging
Transcript: ENSMUST00000038753
AA Change: E836G

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000044276
Gene: ENSMUSG00000040711
AA Change: E836G

DomainStartEndE-ValueType
PX 5 125 2.65e-30 SMART
SH3 155 210 1.11e-14 SMART
SH3 224 279 3.78e-17 SMART
SH3 371 426 2.33e-8 SMART
low complexity region 525 540 N/A INTRINSIC
low complexity region 748 772 N/A INTRINSIC
SH3 850 908 5.75e-8 SMART
Meta Mutation Damage Score 0.0644 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an adapter protein that is characterized by a PX domain and four Src homology 3 domains. The encoded protein is required for podosome formation and is involved in cell adhesion and migration of numerous cell types. Mutations in this gene are the cause of Frank-ter Haar syndrome (FTHS), and also Borrone Dermato-Cardio-Skeletal (BDCS) syndrome. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a spontaneous mutation exhibit abnormal craniofacial morphology, decreased bone density, impaired hearing secondary to otis media, reduced growth, size, and weight, and decreased white adipose tissue. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,223,092 C1933S probably benign Het
4930438A08Rik A G 11: 58,288,350 Y170C probably damaging Het
Adcy2 C T 13: 68,888,042 V167I probably benign Het
Agl A G 3: 116,752,176 Y1324H probably damaging Het
Arhgef37 G T 18: 61,508,789 Q170K probably damaging Het
Asah2 A G 19: 32,016,776 S390P probably damaging Het
Atp8a1 A T 5: 67,774,725 H240Q probably benign Het
Btbd16 T A 7: 130,788,827 N151K probably damaging Het
Ccdc73 T A 2: 104,973,154 probably benign Het
Cecr2 G T 6: 120,758,198 M21I probably benign Het
Ckap2l T C 2: 129,285,716 T181A probably benign Het
Col4a3 T C 1: 82,652,158 probably benign Het
Dnah9 A G 11: 66,081,248 probably benign Het
Fat3 T C 9: 16,375,123 T1035A probably benign Het
Fzd8 A G 18: 9,212,947 T10A unknown Het
Gm11639 T C 11: 104,720,880 L516P possibly damaging Het
Gm9631 C A 11: 121,942,502 C636F probably damaging Het
Gp1ba A G 11: 70,640,788 probably benign Het
Gsk3a A G 7: 25,231,709 V277A probably damaging Het
H2-M1 T A 17: 36,670,228 probably benign Het
Hesx1 T A 14: 27,000,852 W45R probably damaging Het
Il23r T A 6: 67,486,333 M59L possibly damaging Het
Insc T A 7: 114,845,077 V433E probably benign Het
Itga8 T C 2: 12,191,242 probably benign Het
Kif13a T A 13: 46,812,823 E436V probably damaging Het
Liph A G 16: 21,995,350 F7S probably benign Het
Lpar2 T C 8: 69,824,173 V204A probably damaging Het
Lrfn4 T A 19: 4,612,640 probably null Het
Man2b2 A T 5: 36,826,058 D182E probably benign Het
Mmp27 T C 9: 7,581,155 probably benign Het
Mrm1 A G 11: 84,814,813 probably benign Het
Mtx3 T C 13: 92,850,361 S271P probably damaging Het
Myh11 A T 16: 14,226,616 M641K possibly damaging Het
Necab2 A G 8: 119,470,931 D332G probably damaging Het
Ngfr A G 11: 95,574,239 I261T possibly damaging Het
Nrap T C 19: 56,357,325 E617G probably damaging Het
Obscn G T 11: 59,050,480 T4505K probably benign Het
Olfr884 G T 9: 38,047,827 V202L probably benign Het
Olfr983 A G 9: 40,092,511 Y148H probably damaging Het
Osbpl11 T A 16: 33,241,730 probably benign Het
Otof A G 5: 30,394,697 V301A probably damaging Het
Phf3 A T 1: 30,811,838 L1145Q probably damaging Het
Phospho2 T A 2: 69,796,196 I232N possibly damaging Het
Pomgnt2 T A 9: 121,982,061 K551N probably damaging Het
Ptchd3 A G 11: 121,831,158 T286A possibly damaging Het
Rnf213 A G 11: 119,441,150 D2396G probably damaging Het
Simc1 G T 13: 54,525,655 M605I possibly damaging Het
Slc12a3 G A 8: 94,329,433 E66K possibly damaging Het
Spg11 T C 2: 122,084,983 N1060S probably benign Het
Supt5 A T 7: 28,329,037 W178R probably damaging Het
Tmem41a G T 16: 21,937,990 F126L probably benign Het
Ube2m T A 7: 13,037,626 Q35L probably benign Het
Usp33 A G 3: 152,380,574 D658G probably damaging Het
Vmn2r12 A T 5: 109,090,507 C456S probably benign Het
Vmn2r81 T A 10: 79,268,600 D352E probably damaging Het
Zfp516 A G 18: 82,987,263 Y764C probably damaging Het
Zswim7 A G 11: 62,276,647 probably benign Het
Other mutations in Sh3pxd2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Sh3pxd2b APN 11 32403993 nonsense probably null
IGL01581:Sh3pxd2b APN 11 32387973 missense possibly damaging 0.64
IGL02067:Sh3pxd2b APN 11 32423095 missense probably benign 0.01
IGL02412:Sh3pxd2b APN 11 32387992 missense probably damaging 0.99
IGL02930:Sh3pxd2b APN 11 32417161 missense possibly damaging 0.91
IGL03299:Sh3pxd2b APN 11 32411448 splice site probably benign
IGL03378:Sh3pxd2b APN 11 32381443 missense probably damaging 1.00
FR4449:Sh3pxd2b UTSW 11 32423065 small insertion probably benign
FR4548:Sh3pxd2b UTSW 11 32423064 small insertion probably benign
FR4548:Sh3pxd2b UTSW 11 32423065 small insertion probably benign
FR4976:Sh3pxd2b UTSW 11 32423055 small insertion probably benign
FR4976:Sh3pxd2b UTSW 11 32423060 small insertion probably benign
R0097:Sh3pxd2b UTSW 11 32403978 missense probably damaging 1.00
R0097:Sh3pxd2b UTSW 11 32403978 missense probably damaging 1.00
R0441:Sh3pxd2b UTSW 11 32423023 missense possibly damaging 0.77
R1456:Sh3pxd2b UTSW 11 32415967 missense probably damaging 1.00
R1616:Sh3pxd2b UTSW 11 32381441 missense possibly damaging 0.90
R1748:Sh3pxd2b UTSW 11 32422203 missense possibly damaging 0.92
R1902:Sh3pxd2b UTSW 11 32423559 makesense probably null
R1977:Sh3pxd2b UTSW 11 32422138 missense probably damaging 1.00
R3761:Sh3pxd2b UTSW 11 32422750 missense probably benign 0.45
R3850:Sh3pxd2b UTSW 11 32411505 missense probably damaging 1.00
R4060:Sh3pxd2b UTSW 11 32422263 missense probably benign 0.16
R4062:Sh3pxd2b UTSW 11 32422263 missense probably benign 0.16
R4064:Sh3pxd2b UTSW 11 32422263 missense probably benign 0.16
R4585:Sh3pxd2b UTSW 11 32396479 missense possibly damaging 0.84
R5278:Sh3pxd2b UTSW 11 32381447 missense probably damaging 1.00
R5652:Sh3pxd2b UTSW 11 32422812 missense probably damaging 1.00
R5827:Sh3pxd2b UTSW 11 32422422 missense probably benign 0.01
R5994:Sh3pxd2b UTSW 11 32407570 missense probably damaging 1.00
R6083:Sh3pxd2b UTSW 11 32422985 missense probably benign 0.30
R6392:Sh3pxd2b UTSW 11 32423302 missense possibly damaging 0.74
R6625:Sh3pxd2b UTSW 11 32422594 missense possibly damaging 0.74
R6649:Sh3pxd2b UTSW 11 32415978 splice site probably null
R7056:Sh3pxd2b UTSW 11 32422737 missense probably benign 0.01
R7131:Sh3pxd2b UTSW 11 32422072 missense probably damaging 1.00
R7192:Sh3pxd2b UTSW 11 32414318 missense probably damaging 1.00
R7911:Sh3pxd2b UTSW 11 32371533 missense probably damaging 1.00
R8026:Sh3pxd2b UTSW 11 32411567 missense probably damaging 1.00
R8027:Sh3pxd2b UTSW 11 32422210 missense probably benign 0.01
RF016:Sh3pxd2b UTSW 11 32423053 small insertion probably benign
RF022:Sh3pxd2b UTSW 11 32423054 small insertion probably benign
RF025:Sh3pxd2b UTSW 11 32423057 small insertion probably benign
RF040:Sh3pxd2b UTSW 11 32423055 small insertion probably benign
RF056:Sh3pxd2b UTSW 11 32423055 small insertion probably benign
RF063:Sh3pxd2b UTSW 11 32423051 small insertion probably benign
X0017:Sh3pxd2b UTSW 11 32414359 missense possibly damaging 0.94
X0028:Sh3pxd2b UTSW 11 32423110 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTGAAGAAAGCAGAGTCGCTCCTG -3'
(R):5'- GGTTTCTACCTGGCAAAGGCTGTG -3'

Sequencing Primer
(F):5'- ATGACATGCGAGGCAAAGGT -3'
(R):5'- TTTGAGACTTCTGGAGAAGCCAC -3'
Posted On2013-07-30