Incidental Mutation 'R7634:Gtf3c3'
ID628253
Institutional Source Beutler Lab
Gene Symbol Gtf3c3
Ensembl Gene ENSMUSG00000041303
Gene Namegeneral transcription factor IIIC, polypeptide 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R7634 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location54396004-54438971 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 54419641 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000039420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041638]
Predicted Effect probably null
Transcript: ENSMUST00000041638
SMART Domains Protein: ENSMUSP00000039420
Gene: ENSMUSG00000041303

DomainStartEndE-ValueType
low complexity region 18 34 N/A INTRINSIC
low complexity region 92 108 N/A INTRINSIC
TPR 145 178 9.24e1 SMART
TPR 179 212 2.36e1 SMART
TPR 213 246 4.58e-4 SMART
TPR 247 280 6.4e1 SMART
Blast:TPR 286 319 6e-9 BLAST
low complexity region 353 365 N/A INTRINSIC
TPR 452 485 1.87e1 SMART
low complexity region 549 560 N/A INTRINSIC
TPR 807 840 3.27e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of the TFIIIC2 complex, which binds to the promoters of small nuclear and cytoplasmic RNA genes in order to recruit RNA polymerase III. The TFIIIC2 complex is composed of six subunits. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadat A T 8: 60,516,068 M116L probably benign Het
Adam25 A G 8: 40,754,846 D383G probably benign Het
Adam26b T A 8: 43,520,997 M323L probably benign Het
Adgrf3 T C 5: 30,202,247 H227R probably benign Het
Antxr1 G A 6: 87,137,291 T498I probably benign Het
Arg1 T A 10: 24,915,729 T285S possibly damaging Het
Arhgdig T C 17: 26,199,391 D206G probably damaging Het
Asb10 C A 5: 24,540,877 C17F possibly damaging Het
Atg2b T C 12: 105,652,120 D891G probably damaging Het
Cacna1h A T 17: 25,392,109 S572T possibly damaging Het
Cenpj T C 14: 56,542,800 T985A probably benign Het
Cfap65 G T 1: 74,902,434 N1780K probably damaging Het
Cyp26c1 T C 19: 37,692,999 Y417H probably damaging Het
Dnajb13 G T 7: 100,503,186 Q308K probably benign Het
Fam107b T C 2: 3,770,740 S3P possibly damaging Het
Gm13762 G T 2: 88,973,657 P78Q probably damaging Het
Gm14025 T A 2: 129,038,272 D578V Het
Gm3127 A G 14: 4,166,014 N64S probably damaging Het
Gm4847 A C 1: 166,632,680 N412K probably benign Het
Guf1 T C 5: 69,564,544 S349P probably damaging Het
Hvcn1 A G 5: 122,233,523 Y42C probably damaging Het
Insm1 A G 2: 146,223,107 Y281C probably damaging Het
Lrrc71 A G 3: 87,742,974 I264T probably damaging Het
Lrriq1 T C 10: 103,200,601 N897S probably damaging Het
Mtmr6 T A 14: 60,296,147 F375I probably damaging Het
Mtor G C 4: 148,452,350 S27T possibly damaging Het
Mylk4 T A 13: 32,708,908 K387N possibly damaging Het
Nadk2 T G 15: 9,092,846 D247E probably benign Het
Nfya T C 17: 48,392,417 T213A probably damaging Het
Nlrp1a A G 11: 71,099,528 V1067A probably benign Het
Nrbp2 C T 15: 76,087,408 R206Q possibly damaging Het
Oas2 A G 5: 120,733,228 V722A probably benign Het
Pcdhb2 G T 18: 37,294,947 probably benign Het
Pdpr T A 8: 111,125,685 H561Q probably damaging Het
Plcz1 A G 6: 140,016,127 F233L probably damaging Het
Ppp1r3d A G 2: 178,413,372 I279T probably damaging Het
Psg17 A G 7: 18,814,491 Y452H probably damaging Het
Reg4 T C 3: 98,233,112 probably null Het
Rint1 A G 5: 23,805,479 T229A probably benign Het
Robo1 T G 16: 73,042,978 probably null Het
Slc22a26 A C 19: 7,802,587 probably null Het
Slc22a7 C T 17: 46,438,230 A54T probably benign Het
Slc52a3 C A 2: 152,004,614 T165N possibly damaging Het
Slc7a11 C T 3: 50,424,037 probably null Het
Smap2 T C 4: 121,016,799 N18S probably benign Het
Spag6l T C 16: 16,777,414 E369G probably damaging Het
Tarsl2 T A 7: 65,676,012 Y445N probably damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tmprss7 C T 16: 45,663,274 G579D probably benign Het
Tpi1 T A 6: 124,812,854 K109* probably null Het
Ttc25 G A 11: 100,561,905 probably null Het
Ttn T C 2: 76,798,512 E14466G possibly damaging Het
Usp40 A T 1: 87,962,430 C903* probably null Het
Vmn2r104 T A 17: 20,041,709 L386F possibly damaging Het
Vmn2r54 G A 7: 12,615,703 P651S probably damaging Het
Wnk4 C A 11: 101,262,895 T261K probably damaging Het
Wnt2b T C 3: 104,947,116 Y342C probably damaging Het
Zbtb8b A G 4: 129,432,962 Y137H probably damaging Het
Other mutations in Gtf3c3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Gtf3c3 APN 1 54415955 missense probably damaging 0.99
IGL00435:Gtf3c3 APN 1 54427535 missense possibly damaging 0.73
IGL01128:Gtf3c3 APN 1 54428876 missense possibly damaging 0.91
R0243:Gtf3c3 UTSW 1 54403536 missense possibly damaging 0.60
R0271:Gtf3c3 UTSW 1 54428812 missense possibly damaging 0.96
R0571:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R0965:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R0968:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1069:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1070:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1111:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1112:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1113:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1114:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1115:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1117:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1118:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1119:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1228:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1230:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1231:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1313:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1313:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1382:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1394:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1395:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1397:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1414:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1430:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1432:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1473:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1497:Gtf3c3 UTSW 1 54437939 missense probably benign
R1556:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1563:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1638:Gtf3c3 UTSW 1 54405119 missense probably damaging 1.00
R1695:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1716:Gtf3c3 UTSW 1 54399260 missense probably damaging 1.00
R1745:Gtf3c3 UTSW 1 54434212 missense probably damaging 1.00
R1767:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1799:Gtf3c3 UTSW 1 54420424 missense possibly damaging 0.82
R1861:Gtf3c3 UTSW 1 54438838 missense possibly damaging 0.87
R1940:Gtf3c3 UTSW 1 54428958 splice site probably benign
R3804:Gtf3c3 UTSW 1 54424007 critical splice donor site probably null
R4496:Gtf3c3 UTSW 1 54424132 missense probably benign 0.03
R4621:Gtf3c3 UTSW 1 54419416 missense probably damaging 1.00
R5131:Gtf3c3 UTSW 1 54419498 splice site probably null
R5320:Gtf3c3 UTSW 1 54405873 missense probably damaging 1.00
R5605:Gtf3c3 UTSW 1 54415926 missense probably benign 0.06
R5854:Gtf3c3 UTSW 1 54419437 missense probably benign 0.01
R6050:Gtf3c3 UTSW 1 54406070 missense probably benign 0.00
R6441:Gtf3c3 UTSW 1 54406038 missense probably benign 0.03
R6892:Gtf3c3 UTSW 1 54415941 missense probably benign 0.00
R7114:Gtf3c3 UTSW 1 54423507 missense probably benign
R7299:Gtf3c3 UTSW 1 54417708 missense probably benign 0.01
R7441:Gtf3c3 UTSW 1 54420448 missense probably benign 0.00
R7586:Gtf3c3 UTSW 1 54403593 missense probably damaging 1.00
R7615:Gtf3c3 UTSW 1 54423572 missense possibly damaging 0.49
R7739:Gtf3c3 UTSW 1 54405039 missense possibly damaging 0.94
R8349:Gtf3c3 UTSW 1 54428909 missense probably damaging 1.00
R8449:Gtf3c3 UTSW 1 54428909 missense probably damaging 1.00
R8755:Gtf3c3 UTSW 1 54428872 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTCAGAGCAAACCAGGGCAC -3'
(R):5'- CTGCTTTGATGACCTTAGCATGAG -3'

Sequencing Primer
(F):5'- GGGCAGAATTATATTCACCAACATC -3'
(R):5'- TCACCTGAGGACATGACATTG -3'
Posted On2020-02-18