Incidental Mutation 'R7615:Scyl3'
ID628265
Institutional Source Beutler Lab
Gene Symbol Scyl3
Ensembl Gene ENSMUSG00000026584
Gene NameSCY1-like 3 (S. cerevisiae)
Synonyms1200016D23Rik, Pace1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.265) question?
Stock #R7615 (G1)
Quality Score62.0073
Status Validated
Chromosome1
Chromosomal Location163929100-163955126 bp(+) (GRCm38)
Type of Mutationintron (3811 bp from exon)
DNA Base Change (assembly) A to T at 163950338 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000095101 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027876] [ENSMUST00000045876] [ENSMUST00000097493] [ENSMUST00000159516] [ENSMUST00000159617] [ENSMUST00000161908] [ENSMUST00000162234] [ENSMUST00000170359]
Predicted Effect probably benign
Transcript: ENSMUST00000027876
SMART Domains Protein: ENSMUSP00000027876
Gene: ENSMUSG00000026584

DomainStartEndE-ValueType
Pfam:Pkinase 32 245 1.9e-7 PFAM
low complexity region 525 541 N/A INTRINSIC
low complexity region 711 731 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000045876
SMART Domains Protein: ENSMUSP00000043143
Gene: ENSMUSG00000041406

DomainStartEndE-ValueType
low complexity region 10 23 N/A INTRINSIC
Pfam:DUF4487 233 779 2.3e-209 PFAM
low complexity region 877 889 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000097493
SMART Domains Protein: ENSMUSP00000095101
Gene: ENSMUSG00000041406

DomainStartEndE-ValueType
low complexity region 10 23 N/A INTRINSIC
Pfam:DUF4487 233 779 1.3e-186 PFAM
low complexity region 877 889 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159516
Predicted Effect probably benign
Transcript: ENSMUST00000159617
Predicted Effect probably benign
Transcript: ENSMUST00000161908
SMART Domains Protein: ENSMUSP00000125735
Gene: ENSMUSG00000026584

DomainStartEndE-ValueType
Pfam:Pkinase 25 274 1.5e-8 PFAM
low complexity region 512 528 N/A INTRINSIC
low complexity region 698 718 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162234
Predicted Effect probably benign
Transcript: ENSMUST00000170359
SMART Domains Protein: ENSMUSP00000132109
Gene: ENSMUSG00000026584

DomainStartEndE-ValueType
Pfam:Pkinase 25 274 1.5e-8 PFAM
low complexity region 512 528 N/A INTRINSIC
low complexity region 698 718 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (101/101)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a kinase domain and four HEAT repeats. The encoded protein interacts with the C-terminal domain of ezrin, an ERM protein, and may play a role in cell adhesion and migration. Alternative splicing results in multiple transcript variants encoding multiple isoforms. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406B18Rik T C 7: 43,497,849 I320V possibly damaging Het
Adat2 A G 10: 13,553,276 K4R probably benign Het
Adgb G A 10: 10,436,010 L226F probably damaging Het
Adgrb3 C T 1: 25,098,897 V1192I probably damaging Het
Ahsa2 T A 11: 23,496,750 N71I possibly damaging Het
Amigo2 T G 15: 97,245,342 T400P probably damaging Het
Ankhd1 A T 18: 36,656,773 Q466L Het
Auh T C 13: 52,919,013 I111V probably benign Het
Brwd1 A G 16: 96,033,839 F942L probably damaging Het
C1qtnf7 A G 5: 43,616,144 N262D probably damaging Het
Cdh9 T A 15: 16,856,230 S785R probably damaging Het
Celsr3 A G 9: 108,837,652 T2046A possibly damaging Het
Cep170b T C 12: 112,744,665 V1493A probably damaging Het
Cep290 C T 10: 100,492,681 R111W probably benign Het
Chd2 T A 7: 73,441,642 H1617L probably damaging Het
Clnk T C 5: 38,706,698 D404G probably damaging Het
Col18a1 C T 10: 77,067,005 G795D probably damaging Het
Csf3r T A 4: 126,037,656 Y477* probably null Het
Ddx58 T A 4: 40,229,653 I89F possibly damaging Het
Dnah17 T A 11: 118,110,547 K857* probably null Het
Dnah2 T G 11: 69,435,304 I3674L probably damaging Het
Dnah6 A C 6: 73,095,206 I2431S possibly damaging Het
Eml6 T A 11: 29,802,501 I971F possibly damaging Het
Fam135b A T 15: 71,463,323 I674N probably damaging Het
Fancc T A 13: 63,317,558 probably null Het
Gabrb2 A C 11: 42,626,742 K464Q probably benign Het
Gbp4 T A 5: 105,122,982 D261V possibly damaging Het
Gdf3 A G 6: 122,606,916 V164A probably benign Het
Gm19410 A G 8: 35,796,359 D978G probably damaging Het
Gm20730 C T 6: 43,081,774 G35R probably null Het
Gm9733 A G 3: 15,320,485 V119A probably damaging Het
Grin2b G A 6: 135,923,364 T173I probably damaging Het
Gtf3c3 A T 1: 54,423,572 V344E possibly damaging Het
Hsd3b5 A G 3: 98,630,104 I32T probably damaging Het
Ido1 G C 8: 24,593,188 L74V probably damaging Het
Igkv1-88 T A 6: 68,862,373 D85V probably damaging Het
Il22ra1 A G 4: 135,737,459 I159V probably benign Het
Iqgap1 A T 7: 80,730,100 F1175Y probably damaging Het
Iqgap1 A G 7: 80,751,346 V531A probably benign Het
Itga1 T A 13: 114,996,922 Q484L probably null Het
Itga11 A T 9: 62,744,018 E281V probably benign Het
Kpna3 T C 14: 61,372,962 N343S possibly damaging Het
Larp1b A G 3: 41,033,534 K64E possibly damaging Het
Larp1b A G 3: 41,035,816 N133S probably benign Het
Lctl T A 9: 64,122,110 L161H probably damaging Het
Mlip A G 9: 77,230,483 S381P probably damaging Het
Mroh9 A G 1: 163,046,032 I518T probably benign Het
Mst1r A G 9: 107,920,012 Q1360R probably benign Het
Muc5b T A 7: 141,864,892 C3858* probably null Het
Naip1 A T 13: 100,425,776 H960Q probably benign Het
Narfl C T 17: 25,782,129 P452S probably benign Het
Neo1 A T 9: 58,884,503 S1321T probably benign Het
Nid2 C A 14: 19,802,530 T1102K probably damaging Het
Nsmaf C T 4: 6,408,563 V739M probably damaging Het
Olfr1019 T A 2: 85,841,657 M45L probably benign Het
Olfr1167 T C 2: 88,149,518 Q167R probably benign Het
Olfr1464-ps1 A G 19: 13,282,590 I156T probably damaging Het
Olfr727 T G 14: 50,126,989 S137R probably benign Het
Olfr97 T G 17: 37,231,450 K307Q probably benign Het
Osbpl9 G A 4: 109,086,339 P159S probably damaging Het
Parpbp A G 10: 88,093,637 S450P probably damaging Het
Pdgfrb A G 18: 61,064,046 T185A probably benign Het
Pkd1 T C 17: 24,593,502 V3803A probably damaging Het
Plau A T 14: 20,839,466 K200* probably null Het
Plce1 A T 19: 38,524,665 Q136L probably benign Het
Plekhd1 C T 12: 80,722,445 T493I probably benign Het
Pofut1 T C 2: 153,259,418 S31P unknown Het
Prlr T A 15: 10,325,924 I243N probably damaging Het
Ptgis A G 2: 167,223,988 L174P probably damaging Het
Ralgapb T A 2: 158,450,270 I792K probably damaging Het
Retreg3 C T 11: 101,102,980 S136N probably damaging Het
Rnf213 C T 11: 119,467,297 T4291M Het
Rtn1 A G 12: 72,304,143 Y431H probably damaging Het
Rwdd3 A G 3: 121,171,604 probably benign Het
Sh2b2 G T 5: 136,219,657 Q510K probably damaging Het
Sh2b3 G A 5: 121,818,700 P333S probably benign Het
Slc27a6 A T 18: 58,609,183 N490Y probably damaging Het
Slc45a1 C T 4: 150,638,545 R294Q probably benign Het
Sorl1 A C 9: 41,977,582 I1974S possibly damaging Het
Specc1l C A 10: 75,263,286 N857K probably benign Het
Speg T C 1: 75,429,242 L3030P probably damaging Het
Spsb1 A C 4: 149,906,900 D70E probably benign Het
Srsf11 A G 3: 158,016,425 S270P unknown Het
Ssr3 A C 3: 65,387,792 V100G probably damaging Het
Synpo G A 18: 60,604,475 T133I probably damaging Het
Tas2r120 T G 6: 132,657,810 V285G probably benign Het
Tenm4 T A 7: 96,845,926 V1187D probably damaging Het
Tmed8 C A 12: 87,181,388 probably null Het
Tmem51 G A 4: 142,037,564 T61M probably damaging Het
Tonsl A T 15: 76,630,607 D1132E probably benign Het
Tor1aip1 C T 1: 156,007,584 V358I possibly damaging Het
Txlna A T 4: 129,630,319 M415K probably damaging Het
Tyms T A 5: 30,073,560 probably benign Het
Uggt2 G T 14: 119,089,269 L177I probably benign Het
Uqcrh T C 4: 116,069,879 H74R probably benign Het
Wnk1 A T 6: 119,932,738 S33T probably benign Het
Zfp553 T A 7: 127,236,016 C248S probably damaging Het
Zfp574 G A 7: 25,080,576 C341Y possibly damaging Het
Zfp729b T C 13: 67,591,498 T883A possibly damaging Het
Zfp738 T A 13: 67,670,203 K556N probably damaging Het
Other mutations in Scyl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01102:Scyl3 APN 1 163934769 nonsense probably null
IGL03410:Scyl3 APN 1 163944867 missense probably damaging 1.00
R0017:Scyl3 UTSW 1 163939969 missense possibly damaging 0.53
R0017:Scyl3 UTSW 1 163939969 missense possibly damaging 0.53
R1138:Scyl3 UTSW 1 163933665 missense possibly damaging 0.47
R1363:Scyl3 UTSW 1 163950690 missense probably benign 0.01
R1564:Scyl3 UTSW 1 163939984 critical splice donor site probably null
R1843:Scyl3 UTSW 1 163950675 missense probably benign
R1856:Scyl3 UTSW 1 163933696 splice site probably null
R3873:Scyl3 UTSW 1 163950637 missense probably benign 0.00
R4018:Scyl3 UTSW 1 163936499 missense possibly damaging 0.83
R4746:Scyl3 UTSW 1 163949251 missense probably damaging 1.00
R4940:Scyl3 UTSW 1 163934747 missense probably damaging 1.00
R5408:Scyl3 UTSW 1 163954676 utr 3 prime probably null
R6125:Scyl3 UTSW 1 163950576 missense probably benign
R6268:Scyl3 UTSW 1 163946217 nonsense probably null
R6374:Scyl3 UTSW 1 163949214 missense probably benign 0.12
R7397:Scyl3 UTSW 1 163950918 intron probably null
R7489:Scyl3 UTSW 1 163949176 missense possibly damaging 0.94
R7529:Scyl3 UTSW 1 163943869 missense probably damaging 0.99
R8089:Scyl3 UTSW 1 163936427 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- AGTTTCCTGGTAATTGTTAAGCCTG -3'
(R):5'- CTGCAGACAACATGCATGGG -3'

Sequencing Primer
(F):5'- GGTAATTGTTAAGCCTGCTTTCC -3'
(R):5'- CCTTGGACATGATTGGTGAGCAAC -3'
Posted On2020-02-20