Incidental Mutation 'R7632:Pogz'
ID 628271
Institutional Source Beutler Lab
Gene Symbol Pogz
Ensembl Gene ENSMUSG00000038902
Gene Name pogo transposable element with ZNF domain
Synonyms 9530006B08Rik
MMRRC Submission 045720-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.771) question?
Stock # R7632 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 94744878-94789637 bp(+) (GRCm39)
Type of Mutation splice site (5 bp from exon)
DNA Base Change (assembly) G to A at 94763517 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000102891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042402] [ENSMUST00000107266] [ENSMUST00000107269] [ENSMUST00000107270]
AlphaFold Q8BZH4
Predicted Effect probably null
Transcript: ENSMUST00000042402
SMART Domains Protein: ENSMUSP00000037523
Gene: ENSMUSG00000038902

DomainStartEndE-ValueType
low complexity region 9 16 N/A INTRINSIC
low complexity region 41 54 N/A INTRINSIC
low complexity region 239 266 N/A INTRINSIC
low complexity region 328 335 N/A INTRINSIC
PDB:2E72|A 362 393 5e-16 PDB
low complexity region 401 436 N/A INTRINSIC
ZnF_C2H2 482 504 1.64e-1 SMART
ZnF_C2H2 518 541 5.34e0 SMART
ZnF_C2H2 548 571 4.79e-3 SMART
ZnF_C2H2 578 601 9.3e-1 SMART
ZnF_C2H2 607 629 3.34e-2 SMART
ZnF_C2H2 635 657 1.13e1 SMART
ZnF_C2H2 758 781 9.46e0 SMART
ZnF_C2H2 802 827 5.26e1 SMART
low complexity region 896 915 N/A INTRINSIC
low complexity region 946 955 N/A INTRINSIC
low complexity region 984 996 N/A INTRINSIC
CENPB 1008 1072 3.84e-15 SMART
Pfam:DDE_1 1104 1289 3.3e-22 PFAM
low complexity region 1355 1365 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107266
SMART Domains Protein: ENSMUSP00000102887
Gene: ENSMUSG00000038902

DomainStartEndE-ValueType
low complexity region 9 16 N/A INTRINSIC
low complexity region 186 213 N/A INTRINSIC
low complexity region 284 291 N/A INTRINSIC
PDB:2E72|A 318 349 6e-16 PDB
low complexity region 357 392 N/A INTRINSIC
ZnF_C2H2 438 460 1.64e-1 SMART
ZnF_C2H2 474 497 5.34e0 SMART
ZnF_C2H2 504 527 4.79e-3 SMART
ZnF_C2H2 534 557 9.3e-1 SMART
ZnF_C2H2 563 585 3.34e-2 SMART
ZnF_C2H2 591 613 1.13e1 SMART
ZnF_C2H2 714 737 9.46e0 SMART
ZnF_C2H2 758 783 5.26e1 SMART
low complexity region 852 871 N/A INTRINSIC
low complexity region 902 911 N/A INTRINSIC
low complexity region 940 952 N/A INTRINSIC
CENPB 964 1028 3.84e-15 SMART
Pfam:DDE_1 1060 1245 1.1e-22 PFAM
low complexity region 1311 1321 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107269
SMART Domains Protein: ENSMUSP00000102890
Gene: ENSMUSG00000038902

DomainStartEndE-ValueType
low complexity region 9 16 N/A INTRINSIC
low complexity region 41 54 N/A INTRINSIC
low complexity region 144 171 N/A INTRINSIC
low complexity region 242 249 N/A INTRINSIC
PDB:2E72|A 276 307 5e-16 PDB
low complexity region 315 350 N/A INTRINSIC
ZnF_C2H2 396 418 1.64e-1 SMART
ZnF_C2H2 432 455 5.34e0 SMART
ZnF_C2H2 462 485 4.79e-3 SMART
ZnF_C2H2 492 515 9.3e-1 SMART
ZnF_C2H2 521 543 3.34e-2 SMART
ZnF_C2H2 549 571 1.13e1 SMART
ZnF_C2H2 672 695 9.46e0 SMART
ZnF_C2H2 716 741 5.26e1 SMART
low complexity region 810 829 N/A INTRINSIC
low complexity region 860 869 N/A INTRINSIC
low complexity region 898 910 N/A INTRINSIC
CENPB 922 986 3.84e-15 SMART
Pfam:DDE_1 1018 1203 1.1e-22 PFAM
low complexity region 1269 1279 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107270
SMART Domains Protein: ENSMUSP00000102891
Gene: ENSMUSG00000038902

DomainStartEndE-ValueType
low complexity region 9 16 N/A INTRINSIC
low complexity region 41 54 N/A INTRINSIC
low complexity region 239 266 N/A INTRINSIC
low complexity region 337 344 N/A INTRINSIC
PDB:2E72|A 371 402 5e-16 PDB
low complexity region 410 445 N/A INTRINSIC
ZnF_C2H2 491 513 1.64e-1 SMART
ZnF_C2H2 527 550 5.34e0 SMART
ZnF_C2H2 557 580 4.79e-3 SMART
ZnF_C2H2 587 610 9.3e-1 SMART
ZnF_C2H2 616 638 3.34e-2 SMART
ZnF_C2H2 644 666 1.13e1 SMART
ZnF_C2H2 767 790 9.46e0 SMART
ZnF_C2H2 811 836 5.26e1 SMART
low complexity region 905 924 N/A INTRINSIC
low complexity region 955 964 N/A INTRINSIC
low complexity region 993 1005 N/A INTRINSIC
CENPB 1017 1081 3.84e-15 SMART
Pfam:DDE_1 1150 1298 1.5e-18 PFAM
low complexity region 1364 1374 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 95% (63/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene appears to be a zinc finger protein containing a transposase domain at the C-terminus. This protein was found to interact with the transcription factor SP1 in a yeast two-hybrid system. Alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Aug 2010]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap2a2 A G 7: 141,211,236 (GRCm39) D924G probably benign Het
Armh1 C A 4: 117,070,938 (GRCm39) A396S probably benign Het
Atrnl1 A G 19: 57,618,738 (GRCm39) D152G probably damaging Het
B3gnt8 A G 7: 25,327,860 (GRCm39) I97V possibly damaging Het
Bach1 A G 16: 87,517,031 (GRCm39) D524G probably benign Het
Caprin2 T C 6: 148,784,954 (GRCm39) S107G probably damaging Het
Ccnb1 A G 13: 100,918,209 (GRCm39) I207T probably benign Het
Cdh11 T C 8: 103,400,515 (GRCm39) D151G probably damaging Het
Cdh9 A G 15: 16,851,115 (GRCm39) probably null Het
Cep83 A T 10: 94,586,502 (GRCm39) R433W probably damaging Het
Cspg4b C A 13: 113,457,420 (GRCm39) S1155R Het
D3Ertd751e A G 3: 41,708,163 (GRCm39) E100G probably benign Het
Dchs2 C T 3: 83,255,357 (GRCm39) A2351V probably benign Het
Dhx40 T C 11: 86,690,263 (GRCm39) T253A probably benign Het
Dqx1 A G 6: 83,036,680 (GRCm39) D228G probably benign Het
Dync1h1 T C 12: 110,627,327 (GRCm39) M4002T probably benign Het
Flcn C T 11: 59,686,625 (GRCm39) W376* probably null Het
Flnc A T 6: 29,446,984 (GRCm39) Y1037F probably damaging Het
Fut11 T A 14: 20,745,096 (GRCm39) V9E probably benign Het
Fv1 T A 4: 147,954,392 (GRCm39) N319K possibly damaging Het
Ghrhr G T 6: 55,361,727 (GRCm39) G298V probably benign Het
Gm5800 T A 14: 51,953,905 (GRCm39) probably null Het
Grin2b A G 6: 135,709,553 (GRCm39) M1331T probably benign Het
Hyou1 A G 9: 44,292,433 (GRCm39) probably null Het
Igkv1-117 C A 6: 68,098,792 (GRCm39) Q114K probably damaging Het
Igkv4-68 A G 6: 69,282,048 (GRCm39) V41A possibly damaging Het
Inpp4b A G 8: 82,772,968 (GRCm39) N754S probably damaging Het
Isl2 G A 9: 55,448,440 (GRCm39) probably null Het
Kat2a G A 11: 100,599,422 (GRCm39) Q523* probably null Het
Lypd3 T C 7: 24,337,865 (GRCm39) F77S possibly damaging Het
Map4k2 T C 19: 6,394,084 (GRCm39) L297P probably benign Het
Naca T C 10: 127,876,375 (GRCm39) V469A unknown Het
Notch3 C T 17: 32,377,480 (GRCm39) V199I probably benign Het
Or4k44 T C 2: 111,368,521 (GRCm39) I38V possibly damaging Het
Or5b119 T C 19: 13,456,795 (GRCm39) M256V possibly damaging Het
Pabpc1 TGTACCTGTTGCATGGTA TGTA 15: 36,598,212 (GRCm39) probably null Het
Pcdhb8 A T 18: 37,488,648 (GRCm39) I109L probably benign Het
Pde2a A G 7: 101,133,801 (GRCm39) D104G possibly damaging Het
Phip A G 9: 82,785,243 (GRCm39) V824A probably benign Het
Plekhg4 T C 8: 106,106,782 (GRCm39) Y853H probably damaging Het
Plod1 T C 4: 148,011,481 (GRCm39) K248R probably damaging Het
Plxnd1 A T 6: 115,953,600 (GRCm39) Y656N probably benign Het
Ppp1r3e T A 14: 55,114,526 (GRCm39) S79C probably damaging Het
Pprc1 T A 19: 46,060,721 (GRCm39) D1595E probably damaging Het
Ptprq A G 10: 107,547,783 (GRCm39) V205A probably benign Het
Rad51ap2 T C 12: 11,507,116 (GRCm39) V346A possibly damaging Het
Rgs12 T A 5: 35,122,934 (GRCm39) L239H probably damaging Het
Rrp8 T C 7: 105,385,727 (GRCm39) probably benign Het
Rsf1 GGCG GGCGACCGCCGCG 7: 97,229,113 (GRCm39) probably benign Het
Scaf1 A T 7: 44,656,503 (GRCm39) V792D unknown Het
Scrn2 G T 11: 96,923,968 (GRCm39) R284L possibly damaging Het
Sgsm1 T A 5: 113,423,948 (GRCm39) Q461L possibly damaging Het
Slc18b1 A G 10: 23,702,080 (GRCm39) T434A probably benign Het
Sltm C G 9: 70,493,955 (GRCm39) P802R possibly damaging Het
Smc4 CTA CTATA 3: 68,925,400 (GRCm39) probably benign Het
Snx33 A T 9: 56,833,702 (GRCm39) D122E probably damaging Het
Srebf2 G T 15: 82,069,497 (GRCm39) V680L probably benign Het
Sry GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG Y: 2,662,638 (GRCm39) probably benign Het
Tecpr1 C T 5: 144,155,544 (GRCm39) V5M probably benign Het
Tfg A G 16: 56,532,997 (GRCm39) V54A possibly damaging Het
Tmem237 C T 1: 59,156,060 (GRCm39) C30Y probably benign Het
Tmem245 T C 4: 56,916,787 (GRCm39) K444R probably benign Het
Trim25 T G 11: 88,906,602 (GRCm39) L446R probably null Het
Usp37 T C 1: 74,507,533 (GRCm39) T495A probably benign Het
Vmn1r94 T G 7: 19,901,696 (GRCm39) T203P probably damaging Het
Ywhah T A 5: 33,184,010 (GRCm39) M71K probably benign Het
Other mutations in Pogz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02127:Pogz APN 3 94,782,014 (GRCm39) unclassified probably benign
IGL02225:Pogz APN 3 94,786,327 (GRCm39) missense probably damaging 0.99
IGL02377:Pogz APN 3 94,786,321 (GRCm39) missense probably damaging 1.00
IGL02468:Pogz APN 3 94,786,394 (GRCm39) missense probably damaging 0.97
IGL02672:Pogz APN 3 94,763,410 (GRCm39) missense probably benign 0.08
IGL03290:Pogz APN 3 94,782,402 (GRCm39) unclassified probably benign
FR4976:Pogz UTSW 3 94,782,006 (GRCm39) unclassified probably benign
PIT4382001:Pogz UTSW 3 94,787,107 (GRCm39) missense probably damaging 1.00
PIT4434001:Pogz UTSW 3 94,779,681 (GRCm39) missense probably damaging 1.00
R0326:Pogz UTSW 3 94,777,424 (GRCm39) missense probably damaging 1.00
R0401:Pogz UTSW 3 94,784,336 (GRCm39) missense possibly damaging 0.81
R0479:Pogz UTSW 3 94,783,947 (GRCm39) missense possibly damaging 0.92
R0586:Pogz UTSW 3 94,786,664 (GRCm39) missense probably damaging 1.00
R1349:Pogz UTSW 3 94,768,199 (GRCm39) missense probably damaging 1.00
R1372:Pogz UTSW 3 94,768,199 (GRCm39) missense probably damaging 1.00
R1670:Pogz UTSW 3 94,786,160 (GRCm39) missense probably benign 0.21
R1780:Pogz UTSW 3 94,777,437 (GRCm39) missense possibly damaging 0.54
R1854:Pogz UTSW 3 94,786,160 (GRCm39) missense probably benign 0.21
R1855:Pogz UTSW 3 94,786,160 (GRCm39) missense probably benign 0.21
R1964:Pogz UTSW 3 94,785,504 (GRCm39) missense probably benign 0.36
R1995:Pogz UTSW 3 94,785,255 (GRCm39) missense probably damaging 1.00
R2109:Pogz UTSW 3 94,786,276 (GRCm39) missense probably benign
R2139:Pogz UTSW 3 94,778,318 (GRCm39) missense possibly damaging 0.95
R4457:Pogz UTSW 3 94,763,374 (GRCm39) missense probably benign 0.14
R4598:Pogz UTSW 3 94,787,491 (GRCm39) missense possibly damaging 0.52
R5598:Pogz UTSW 3 94,771,820 (GRCm39) missense probably damaging 1.00
R5999:Pogz UTSW 3 94,763,428 (GRCm39) missense possibly damaging 0.77
R6104:Pogz UTSW 3 94,787,342 (GRCm39) missense probably benign 0.09
R7017:Pogz UTSW 3 94,761,335 (GRCm39) missense probably damaging 0.99
R7788:Pogz UTSW 3 94,782,544 (GRCm39) missense probably damaging 0.99
R7810:Pogz UTSW 3 94,777,418 (GRCm39) missense probably benign 0.00
R8396:Pogz UTSW 3 94,786,061 (GRCm39) missense probably benign 0.00
R8681:Pogz UTSW 3 94,768,234 (GRCm39) missense probably damaging 1.00
R8981:Pogz UTSW 3 94,786,226 (GRCm39) missense probably damaging 0.96
R8982:Pogz UTSW 3 94,786,879 (GRCm39) missense probably damaging 1.00
R9024:Pogz UTSW 3 94,785,543 (GRCm39) missense probably damaging 1.00
R9056:Pogz UTSW 3 94,787,530 (GRCm39) missense probably benign 0.02
R9316:Pogz UTSW 3 94,784,659 (GRCm39) missense probably damaging 1.00
RF014:Pogz UTSW 3 94,785,558 (GRCm39) missense possibly damaging 0.77
Z1088:Pogz UTSW 3 94,786,387 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCCCTGTCTCCAAGTGACTATG -3'
(R):5'- GTCTTCTGGAACCTGCTGAC -3'

Sequencing Primer
(F):5'- GTCTCCAAGTGACTATGCCTTC -3'
(R):5'- GAACCTGCTGACCTGACTCAGTC -3'
Posted On 2020-02-21