Mutagenetix > Incidental Mutation

Incidental Mutation 'R7632:Cdh9'

628275

Institutional Source

Beutler Lab

Gene Symbol

Cdh9

Ensembl Gene

ENSMUSG00000025370

Gene Name

cadherin 9

Synonyms

T1-cadherin

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.104) question?

Stock #

R7632 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

16728756-16857094 bp(+) (GRCm38)

Type of Mutation

splice site (4 bp from exon)

DNA Base Change (assembly)

A to G at 16851029 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000154022 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026432] [ENSMUST00000228307]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000026432

SMART Domains

Protein: ENSMUSP00000026432
Gene: ENSMUSG00000025370

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
CA	75	156	2.84e-15	SMART
CA	180	265	5.63e-28	SMART
CA	289	381	1.12e-13	SMART
CA	404	485	8.03e-24	SMART
CA	508	595	1.34e-2	SMART
transmembrane domain	613	635	N/A	INTRINSIC
Pfam:Cadherin_C	638	782	1.5e-54	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000228307

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.5%

Validation Efficiency

95% (63/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type II classical cadherin from the cadherin superfamily, integral membrane proteins that mediate calcium-dependent cell-cell adhesion. Mature cadherin proteins are composed of a large N-terminal extracellular domain, a single membrane-spanning domain, and a small, highly conserved C-terminal cytoplasmic domain. The extracellular domain consists of 5 subdomains, each containing a cadherin motif, and appears to determine the specificity of the protein's homophilic cell adhesion activity. Type II (atypical) cadherins are defined based on their lack of a HAV cell adhesion recognition sequence specific to type I cadherins. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous knockout results in the formation of abnormal axonal arbors in some retinal type 5 bipolar cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ap2a2	A	G	7: 141,631,323	D924G	probably benign	Het
Armh1	C	A	4: 117,213,741	A396S	probably benign	Het
Atrnl1	A	G	19: 57,630,306	D152G	probably damaging	Het
B3gnt8	A	G	7: 25,628,435	I97V	possibly damaging	Het
Bach1	A	G	16: 87,720,143	D524G	probably benign	Het
BC067074	C	A	13: 113,320,886	S1155R		Het
Caprin2	T	C	6: 148,883,456	S107G	probably damaging	Het
Ccnb1	A	G	13: 100,781,701	I207T	probably benign	Het
Cdh11	T	C	8: 102,673,883	D151G	probably damaging	Het
Cep83	A	T	10: 94,750,640	R433W	probably damaging	Het
D3Ertd751e	A	G	3: 41,753,728	E100G	probably benign	Het
Dchs2	C	T	3: 83,348,050	A2351V	probably benign	Het
Dhx40	T	C	11: 86,799,437	T253A	probably benign	Het
Dqx1	A	G	6: 83,059,699	D228G	probably benign	Het
Dync1h1	T	C	12: 110,660,893	M4002T	probably benign	Het
Flcn	C	T	11: 59,795,799	W376*	probably null	Het
Flnc	A	T	6: 29,446,985	Y1037F	probably damaging	Het
Fut11	T	A	14: 20,695,028	V9E	probably benign	Het
Fv1	T	A	4: 147,869,935	N319K	possibly damaging	Het
Ghrhr	G	T	6: 55,384,742	G298V	probably benign	Het
Gm5800	T	A	14: 51,716,448		probably null	Het
Grin2b	A	G	6: 135,732,555	M1331T	probably benign	Het
Hyou1	A	G	9: 44,381,136		probably null	Het
Igkv1-117	C	A	6: 68,121,808	Q114K	probably damaging	Het
Igkv4-68	A	G	6: 69,305,064	V41A	possibly damaging	Het
Inpp4b	A	G	8: 82,046,339	N754S	probably damaging	Het
Isl2	G	A	9: 55,541,156		probably null	Het
Kat2a	G	A	11: 100,708,596	Q523*	probably null	Het
Lypd3	T	C	7: 24,638,440	F77S	possibly damaging	Het
Map4k2	T	C	19: 6,344,054	L297P	probably benign	Het
Naca	T	C	10: 128,040,506	V469A	unknown	Het
Notch3	C	T	17: 32,158,506	V199I	probably benign	Het
Olfr1294	T	C	2: 111,538,176	I38V	possibly damaging	Het
Olfr1475	T	C	19: 13,479,431	M256V	possibly damaging	Het
Pabpc1	TGTACCTGTTGCATGGTA	TGTA	15: 36,597,968		probably null	Het
Pcdhb8	A	T	18: 37,355,595	I109L	probably benign	Het
Pde2a	A	G	7: 101,484,594	D104G	possibly damaging	Het
Phip	A	G	9: 82,903,190	V824A	probably benign	Het
Plekhg4	T	C	8: 105,380,150	Y853H	probably damaging	Het
Plod1	T	C	4: 147,927,024	K248R	probably damaging	Het
Plxnd1	A	T	6: 115,976,639	Y656N	probably benign	Het
Pogz	G	A	3: 94,856,206		probably null	Het
Ppp1r3e	T	A	14: 54,877,069	S79C	probably damaging	Het
Pprc1	T	A	19: 46,072,282	D1595E	probably damaging	Het
Ptprq	A	G	10: 107,711,922	V205A	probably benign	Het
Rad51ap2	T	C	12: 11,457,115	V346A	possibly damaging	Het
Rgs12	T	A	5: 34,965,590	L239H	probably damaging	Het
Rrp8	T	C	7: 105,736,520		probably benign	Het
Rsf1	GGCG	GGCGACCGCCGCG	7: 97,579,906		probably benign	Het
Scaf1	A	T	7: 45,007,079	V792D	unknown	Het
Scrn2	G	T	11: 97,033,142	R284L	possibly damaging	Het
Sgsm1	T	A	5: 113,276,082	Q461L	possibly damaging	Het
Slc18b1	A	G	10: 23,826,182	T434A	probably benign	Het
Sltm	C	G	9: 70,586,673	P802R	possibly damaging	Het
Smc4	CTA	CTATA	3: 69,018,067		probably benign	Het
Snx33	A	T	9: 56,926,418	D122E	probably damaging	Het
Srebf2	G	T	15: 82,185,296	V680L	probably benign	Het
Sry	GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG	GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG	Y: 2,662,638		probably benign	Het
Tecpr1	C	T	5: 144,218,726	V5M	probably benign	Het
Tfg	A	G	16: 56,712,634	V54A	possibly damaging	Het
Tmem237	C	T	1: 59,116,901	C30Y	probably benign	Het
Tmem245	T	C	4: 56,916,787	K444R	probably benign	Het
Trim25	T	G	11: 89,015,776	L446R	probably null	Het
Usp37	T	C	1: 74,468,374	T495A	probably benign	Het
Vmn1r94	T	G	7: 20,167,771	T203P	probably damaging	Het
Ywhah	T	A	5: 33,026,666	M71K	probably benign	Het

Other mutations in Cdh9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00429:Cdh9	APN	15	16828362	missense	probably damaging	1.00
IGL00555:Cdh9	APN	15	16823406	missense	probably damaging	1.00
IGL01110:Cdh9	APN	15	16855926	missense	possibly damaging	0.63
IGL01432:Cdh9	APN	15	16830947	missense	probably damaging	1.00
IGL01768:Cdh9	APN	15	16778225	missense	possibly damaging	0.51
IGL02043:Cdh9	APN	15	16856232	missense	probably damaging	1.00
IGL02304:Cdh9	APN	15	16848601	missense	probably benign	0.01
IGL02380:Cdh9	APN	15	16856000	missense	possibly damaging	0.79
IGL02505:Cdh9	APN	15	16855989	missense	probably damaging	1.00
IGL02675:Cdh9	APN	15	16849076	splice site	probably null
IGL02679:Cdh9	APN	15	16832230	missense	probably damaging	0.97
IGL03288:Cdh9	APN	15	16856049	missense	probably damaging	1.00
R0426:Cdh9	UTSW	15	16823454	critical splice donor site	probably null
R0726:Cdh9	UTSW	15	16831044	missense	probably benign	0.00
R1335:Cdh9	UTSW	15	16850792	missense	probably benign	0.00
R1368:Cdh9	UTSW	15	16848482	splice site	probably benign
R1766:Cdh9	UTSW	15	16778306	missense	probably damaging	1.00
R1916:Cdh9	UTSW	15	16823275	missense	probably benign	0.03
R2325:Cdh9	UTSW	15	16778200	missense	probably benign
R2424:Cdh9	UTSW	15	16850354	missense	probably damaging	1.00
R3104:Cdh9	UTSW	15	16855814	missense	probably damaging	1.00
R3837:Cdh9	UTSW	15	16823438	nonsense	probably null
R3839:Cdh9	UTSW	15	16823438	nonsense	probably null
R4241:Cdh9	UTSW	15	16849079	critical splice acceptor site	probably null
R4248:Cdh9	UTSW	15	16850388	missense	probably benign	0.00
R4576:Cdh9	UTSW	15	16832239	missense	possibly damaging	0.73
R4679:Cdh9	UTSW	15	16850959	missense	probably benign
R4896:Cdh9	UTSW	15	16778156	missense	probably benign	0.12
R4961:Cdh9	UTSW	15	16850828	missense	probably benign
R5050:Cdh9	UTSW	15	16778147	missense	probably benign	0.12
R5089:Cdh9	UTSW	15	16778276	missense	probably damaging	1.00
R5268:Cdh9	UTSW	15	16851013	missense	probably benign
R5567:Cdh9	UTSW	15	16855844	missense	probably damaging	1.00
R5646:Cdh9	UTSW	15	16823285	missense	probably damaging	1.00
R5894:Cdh9	UTSW	15	16832100	missense	possibly damaging	0.47
R6440:Cdh9	UTSW	15	16823423	missense	probably benign	0.01
R6441:Cdh9	UTSW	15	16823423	missense	probably benign	0.01
R7225:Cdh9	UTSW	15	16856073	missense	probably damaging	1.00
R7247:Cdh9	UTSW	15	16778255	missense	probably damaging	1.00
R7593:Cdh9	UTSW	15	16823175	missense	probably damaging	1.00
R7615:Cdh9	UTSW	15	16856230	missense	probably damaging	1.00
R7991:Cdh9	UTSW	15	16828403	missense	probably damaging	1.00
R8035:Cdh9	UTSW	15	16831066	missense	probably damaging	0.97
R8834:Cdh9	UTSW	15	16850878	missense	probably damaging	1.00
R8909:Cdh9	UTSW	15	16848524	missense	probably damaging	1.00
R8936:Cdh9	UTSW	15	16831076	critical splice donor site	probably null
R8973:Cdh9	UTSW	15	16831045	missense	possibly damaging	0.78
R9138:Cdh9	UTSW	15	16823187	missense	probably damaging	1.00
R9305:Cdh9	UTSW	15	16832052	missense	probably damaging	1.00
RF006:Cdh9	UTSW	15	16855830	missense	probably damaging	0.97
X0062:Cdh9	UTSW	15	16848539	missense	possibly damaging	0.81
Z1177:Cdh9	UTSW	15	16850364	missense	probably benign	0.16

Predicted Primers

PCR Primer
(F):5'- ACTGCCGGTTTTAATCTTCGAC -3'
(R):5'- TGTCCAAGGTCATTAGAACCATAAG -3'

Sequencing Primer
(F):5'- ACAATGATTATCCTATTCAAAGCAGC -3'
(R):5'- CAGAGGGCATTGGATCCCATTATAC -3'

Posted On

2020-02-21