Incidental Mutation 'R7624:Scarf1'
ID 628283
Institutional Source Beutler Lab
Gene Symbol Scarf1
Ensembl Gene ENSMUSG00000038188
Gene Name scavenger receptor class F, member 1
Synonyms SREC-I, SREC
MMRRC Submission 045689-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7624 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 75404366-75417408 bp(+) (GRCm39)
Type of Mutation splice site (6 bp from exon)
DNA Base Change (assembly) T to A at 75405242 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000114090 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018449] [ENSMUST00000042808] [ENSMUST00000042808] [ENSMUST00000042808] [ENSMUST00000042972] [ENSMUST00000102510] [ENSMUST00000118243] [ENSMUST00000118243] [ENSMUST00000118243] [ENSMUST00000123819]
AlphaFold Q5ND28
Predicted Effect probably benign
Transcript: ENSMUST00000018449
SMART Domains Protein: ENSMUSP00000018449
Gene: ENSMUSG00000020850

DomainStartEndE-ValueType
Pfam:PRO8NT 58 209 1.6e-84 PFAM
low complexity region 369 388 N/A INTRINSIC
Pfam:PROCN 393 801 3.6e-226 PFAM
low complexity region 802 814 N/A INTRINSIC
Pfam:RRM_4 986 1079 7.1e-49 PFAM
Pfam:U5_2-snRNA_bdg 1208 1343 1.9e-73 PFAM
Pfam:U6-snRNA_bdg 1442 1601 3.7e-97 PFAM
Pfam:PRP8_domainIV 1760 1990 1.5e-132 PFAM
JAB_MPN 2099 2233 9.02e-30 SMART
Predicted Effect probably null
Transcript: ENSMUST00000042808
SMART Domains Protein: ENSMUSP00000044248
Gene: ENSMUSG00000038188

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF 54 90 2.16e1 SMART
EGF 101 133 1.36e1 SMART
EGF_like 165 193 4.55e1 SMART
EGF_Lam 225 263 8.78e-2 SMART
EGF_like 262 296 4.93e1 SMART
EGF 307 341 2.69e1 SMART
EGF 352 384 2.25e1 SMART
transmembrane domain 424 446 N/A INTRINSIC
low complexity region 520 535 N/A INTRINSIC
low complexity region 791 805 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000042808
SMART Domains Protein: ENSMUSP00000044248
Gene: ENSMUSG00000038188

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF 54 90 2.16e1 SMART
EGF 101 133 1.36e1 SMART
EGF_like 165 193 4.55e1 SMART
EGF_Lam 225 263 8.78e-2 SMART
EGF_like 262 296 4.93e1 SMART
EGF 307 341 2.69e1 SMART
EGF 352 384 2.25e1 SMART
transmembrane domain 424 446 N/A INTRINSIC
low complexity region 520 535 N/A INTRINSIC
low complexity region 791 805 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000042808
SMART Domains Protein: ENSMUSP00000044248
Gene: ENSMUSG00000038188

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF 54 90 2.16e1 SMART
EGF 101 133 1.36e1 SMART
EGF_like 165 193 4.55e1 SMART
EGF_Lam 225 263 8.78e-2 SMART
EGF_like 262 296 4.93e1 SMART
EGF 307 341 2.69e1 SMART
EGF 352 384 2.25e1 SMART
transmembrane domain 424 446 N/A INTRINSIC
low complexity region 520 535 N/A INTRINSIC
low complexity region 791 805 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000042972
SMART Domains Protein: ENSMUSP00000037238
Gene: ENSMUSG00000038195

DomainStartEndE-ValueType
low complexity region 14 24 N/A INTRINSIC
Pfam:Jnk-SapK_ap_N 27 195 2.1e-16 PFAM
Pfam:RILP 223 281 1.1e-21 PFAM
low complexity region 289 298 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102510
SMART Domains Protein: ENSMUSP00000099568
Gene: ENSMUSG00000020850

DomainStartEndE-ValueType
Pfam:PRO8NT 58 209 1.6e-90 PFAM
low complexity region 369 388 N/A INTRINSIC
Pfam:PROCN 395 801 2.9e-239 PFAM
low complexity region 802 814 N/A INTRINSIC
Pfam:RRM_4 986 1077 1.5e-51 PFAM
Pfam:U5_2-snRNA_bdg 1210 1343 1.1e-77 PFAM
Pfam:U6-snRNA_bdg 1442 1600 4.2e-97 PFAM
Pfam:PRP8_domainIV 1760 1989 9.8e-134 PFAM
JAB_MPN 2099 2233 9.02e-30 SMART
Predicted Effect probably null
Transcript: ENSMUST00000118243
SMART Domains Protein: ENSMUSP00000114090
Gene: ENSMUSG00000038188

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF 54 90 2.16e1 SMART
EGF 101 133 1.36e1 SMART
EGF_like 165 193 4.55e1 SMART
EGF_Lam 225 263 8.78e-2 SMART
EGF_like 262 296 4.93e1 SMART
EGF 307 341 2.69e1 SMART
EGF 352 384 2.25e1 SMART
transmembrane domain 424 446 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000118243
SMART Domains Protein: ENSMUSP00000114090
Gene: ENSMUSG00000038188

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF 54 90 2.16e1 SMART
EGF 101 133 1.36e1 SMART
EGF_like 165 193 4.55e1 SMART
EGF_Lam 225 263 8.78e-2 SMART
EGF_like 262 296 4.93e1 SMART
EGF 307 341 2.69e1 SMART
EGF 352 384 2.25e1 SMART
transmembrane domain 424 446 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000118243
SMART Domains Protein: ENSMUSP00000114090
Gene: ENSMUSG00000038188

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF 54 90 2.16e1 SMART
EGF 101 133 1.36e1 SMART
EGF_like 165 193 4.55e1 SMART
EGF_Lam 225 263 8.78e-2 SMART
EGF_like 262 296 4.93e1 SMART
EGF 307 341 2.69e1 SMART
EGF 352 384 2.25e1 SMART
transmembrane domain 424 446 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123819
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a scavenger receptor that is expressed in endothelial cells. It regulates the uptake of chemically modified low density lipoproteins, including acetylated low density lipoprotein (Ac-LDL), and it may be involved in atherogenesis. This gene is regulated by the transcription factors ZNF444/EZF-2 and SP1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2013]
PHENOTYPE: Homozygous null mice are viable and fertile with no abnormalities detected in plasma glucose, cholesterol, or triglycerides, or in the brain, lung, heart, kidney, liver, or testes. Mice homozygous for a targeted allele exhibit impaired clearance of apoptotic cells and autoimmune disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atm C A 9: 53,366,068 (GRCm39) R2533L probably damaging Het
Caprin1 T A 2: 103,603,022 (GRCm39) M514L possibly damaging Het
Ccdc78 A G 17: 26,006,126 (GRCm39) E98G probably damaging Het
Cmya5 A T 13: 93,226,865 (GRCm39) M2741K possibly damaging Het
Cnot1 T G 8: 96,478,447 (GRCm39) R959S probably damaging Het
Col12a1 G T 9: 79,553,076 (GRCm39) probably null Het
Col4a3 A G 1: 82,696,605 (GRCm39) T177A probably benign Het
Cpa3 T C 3: 20,279,307 (GRCm39) N211D possibly damaging Het
Cripto C T 9: 110,775,017 (GRCm39) probably benign Het
Cryba1 T C 11: 77,613,543 (GRCm39) Y36C probably damaging Het
Ctnna1 T A 18: 35,377,897 (GRCm39) I632N probably benign Het
D630045J12Rik T C 6: 38,126,498 (GRCm39) N1504S probably damaging Het
Dgkz C A 2: 91,773,019 (GRCm39) R346L probably damaging Het
Dnajc21 G A 15: 10,461,318 (GRCm39) R211C probably benign Het
Dnajc21 A T 15: 10,461,320 (GRCm39) I210N probably damaging Het
Dscam T C 16: 96,411,524 (GRCm39) D1784G probably damaging Het
Eya3 A G 4: 132,400,262 (GRCm39) T94A probably benign Het
Fan1 T A 7: 64,022,234 (GRCm39) N340Y probably damaging Het
Fat3 T C 9: 15,871,165 (GRCm39) D3742G possibly damaging Het
Ficd T C 5: 113,876,751 (GRCm39) F309L probably benign Het
Gfra1 A T 19: 58,226,878 (GRCm39) M451K probably benign Het
Gm43517 T A 12: 49,437,961 (GRCm39) L318Q Het
Gsc A T 12: 104,439,310 (GRCm39) V22E possibly damaging Het
Il4ra T C 7: 125,168,280 (GRCm39) Y100H probably damaging Het
Ilf3 T C 9: 21,309,340 (GRCm39) S486P probably benign Het
Itga10 T A 3: 96,560,269 (GRCm39) H594Q probably benign Het
Kcnf1 T C 12: 17,226,137 (GRCm39) D28G probably benign Het
Kiss1 A G 1: 133,257,160 (GRCm39) K53R possibly damaging Het
Lcn5 A G 2: 25,551,426 (GRCm39) I182V probably benign Het
Lcorl T C 5: 45,859,307 (GRCm39) D269G probably benign Het
Letm2 A T 8: 26,082,553 (GRCm39) C174* probably null Het
Met T G 6: 17,558,834 (GRCm39) V1154G probably damaging Het
Mindy3 A G 2: 12,424,000 (GRCm39) S22P probably benign Het
Mroh2b G A 15: 4,946,613 (GRCm39) R471Q probably damaging Het
Nfe2l3 T C 6: 51,435,252 (GRCm39) L604P probably damaging Het
Or12e10 A G 2: 87,640,683 (GRCm39) Q173R probably damaging Het
Or14a256 A G 7: 86,265,769 (GRCm39) F28S possibly damaging Het
Or5h18 T A 16: 58,847,382 (GRCm39) Q296L possibly damaging Het
Or8b3b C T 9: 38,583,919 (GRCm39) V274I probably benign Het
Or8u9 A T 2: 86,001,564 (GRCm39) I199N possibly damaging Het
Or9r7 A C 10: 129,962,455 (GRCm39) I157S probably damaging Het
Pcdha9 T A 18: 37,132,849 (GRCm39) Y639* probably null Het
Pom121l2 A T 13: 22,167,699 (GRCm39) I657L probably damaging Het
Prr14l T A 5: 32,986,967 (GRCm39) T843S possibly damaging Het
Rln1 A T 19: 29,309,499 (GRCm39) N93K probably damaging Het
Rpl3l A T 17: 24,951,401 (GRCm39) M101L probably benign Het
Rtkn A G 6: 83,129,158 (GRCm39) Y551C probably benign Het
Rundc1 G C 11: 101,324,305 (GRCm39) R337P possibly damaging Het
Serpinb1b T A 13: 33,275,622 (GRCm39) probably null Het
Sgsm1 A T 5: 113,422,201 (GRCm39) C484* probably null Het
Slc22a19 T A 19: 7,650,668 (GRCm39) K547* probably null Het
Slc22a19 T C 19: 7,671,183 (GRCm39) T177A probably benign Het
Slc6a5 A C 7: 49,591,614 (GRCm39) K526N probably benign Het
Sqle G A 15: 59,202,603 (GRCm39) R519Q probably benign Het
Stard9 T C 2: 120,518,627 (GRCm39) I517T probably benign Het
Taf15 A T 11: 83,395,849 (GRCm39) D518V unknown Het
Tenm4 A G 7: 96,545,192 (GRCm39) M2440V possibly damaging Het
Tm6sf1 A G 7: 81,518,458 (GRCm39) M122V possibly damaging Het
Tmprss9 T A 10: 80,728,053 (GRCm39) S548T possibly damaging Het
Trim62 A T 4: 128,777,471 (GRCm39) probably benign Het
Ugt2b34 C T 5: 87,039,141 (GRCm39) V507M possibly damaging Het
Usp16 T A 16: 87,273,693 (GRCm39) M423K probably benign Het
Vmn1r199 T A 13: 22,566,906 (GRCm39) S67T probably benign Het
Vmn1r62 A T 7: 5,678,600 (GRCm39) M94L probably benign Het
Wnk4 G T 11: 101,155,180 (GRCm39) E364* probably null Het
Xpo1 T A 11: 23,232,584 (GRCm39) I368N probably damaging Het
Zfp366 A G 13: 99,382,804 (GRCm39) T656A probably benign Het
Zfp934 T C 13: 62,666,338 (GRCm39) M113V probably benign Het
Zkscan2 A G 7: 123,097,994 (GRCm39) V134A probably damaging Het
Other mutations in Scarf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01695:Scarf1 APN 11 75,412,783 (GRCm39) missense probably damaging 0.98
IGL02968:Scarf1 APN 11 75,414,915 (GRCm39) missense probably damaging 1.00
R0078:Scarf1 UTSW 11 75,405,988 (GRCm39) splice site probably benign
R0606:Scarf1 UTSW 11 75,405,174 (GRCm39) missense probably damaging 0.98
R0834:Scarf1 UTSW 11 75,405,229 (GRCm39) nonsense probably null
R1715:Scarf1 UTSW 11 75,414,870 (GRCm39) missense probably damaging 1.00
R2327:Scarf1 UTSW 11 75,416,854 (GRCm39) missense probably damaging 1.00
R2483:Scarf1 UTSW 11 75,406,117 (GRCm39) missense probably damaging 0.98
R3699:Scarf1 UTSW 11 75,405,195 (GRCm39) missense probably damaging 1.00
R3831:Scarf1 UTSW 11 75,406,078 (GRCm39) missense probably damaging 1.00
R3832:Scarf1 UTSW 11 75,406,078 (GRCm39) missense probably damaging 1.00
R3833:Scarf1 UTSW 11 75,406,078 (GRCm39) missense probably damaging 1.00
R4957:Scarf1 UTSW 11 75,416,460 (GRCm39) missense probably benign 0.10
R4990:Scarf1 UTSW 11 75,416,841 (GRCm39) missense probably benign 0.00
R4992:Scarf1 UTSW 11 75,416,841 (GRCm39) missense probably benign 0.00
R4992:Scarf1 UTSW 11 75,413,056 (GRCm39) missense probably damaging 1.00
R5291:Scarf1 UTSW 11 75,414,900 (GRCm39) missense probably damaging 1.00
R5330:Scarf1 UTSW 11 75,406,406 (GRCm39) missense probably damaging 1.00
R5331:Scarf1 UTSW 11 75,406,406 (GRCm39) missense probably damaging 1.00
R5537:Scarf1 UTSW 11 75,416,357 (GRCm39) missense probably damaging 1.00
R5583:Scarf1 UTSW 11 75,404,842 (GRCm39) missense possibly damaging 0.95
R5592:Scarf1 UTSW 11 75,416,513 (GRCm39) missense probably benign 0.08
R6130:Scarf1 UTSW 11 75,416,565 (GRCm39) missense probably benign
R6289:Scarf1 UTSW 11 75,416,242 (GRCm39) missense possibly damaging 0.83
R6313:Scarf1 UTSW 11 75,411,141 (GRCm39) missense probably benign 0.02
R6360:Scarf1 UTSW 11 75,406,495 (GRCm39) missense probably damaging 1.00
R6944:Scarf1 UTSW 11 75,413,032 (GRCm39) missense probably benign 0.00
R7113:Scarf1 UTSW 11 75,416,904 (GRCm39) missense probably damaging 0.99
R8191:Scarf1 UTSW 11 75,413,065 (GRCm39) missense probably benign 0.01
R8258:Scarf1 UTSW 11 75,414,689 (GRCm39) missense probably damaging 0.97
R8259:Scarf1 UTSW 11 75,414,689 (GRCm39) missense probably damaging 0.97
R8433:Scarf1 UTSW 11 75,411,858 (GRCm39) critical splice donor site probably null
R9003:Scarf1 UTSW 11 75,406,069 (GRCm39) missense possibly damaging 0.46
R9233:Scarf1 UTSW 11 75,416,720 (GRCm39) missense probably benign
R9292:Scarf1 UTSW 11 75,406,006 (GRCm39) missense probably damaging 1.00
R9345:Scarf1 UTSW 11 75,404,401 (GRCm39) utr 5 prime probably benign
Z1088:Scarf1 UTSW 11 75,416,316 (GRCm39) missense probably damaging 1.00
Z1177:Scarf1 UTSW 11 75,406,073 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCACTAAGGATGGCTTTG -3'
(R):5'- TGGCTGTAGGTTAAAGCCC -3'

Sequencing Primer
(F):5'- GCTTTGAAGGGAGCAGAATCC -3'
(R):5'- GGGTAATTTTGGGCCTTAC -3'
Posted On 2020-02-24