Incidental Mutation 'R7626:Tmem135'
ID628285
Institutional Source Beutler Lab
Gene Symbol Tmem135
Ensembl Gene ENSMUSG00000039428
Gene Nametransmembrane protein 135
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.155) question?
Stock #R7626 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location89139714-89404222 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 89156510 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000114097 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041968] [ENSMUST00000041968] [ENSMUST00000117852] [ENSMUST00000117852]
Predicted Effect probably null
Transcript: ENSMUST00000041968
SMART Domains Protein: ENSMUSP00000042783
Gene: ENSMUSG00000039428

DomainStartEndE-ValueType
Pfam:TMEM135_C_rich 9 142 2.2e-84 PFAM
transmembrane domain 147 169 N/A INTRINSIC
Pfam:Tim17 249 370 1.1e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000041968
SMART Domains Protein: ENSMUSP00000042783
Gene: ENSMUSG00000039428

DomainStartEndE-ValueType
Pfam:TMEM135_C_rich 9 142 2.2e-84 PFAM
transmembrane domain 147 169 N/A INTRINSIC
Pfam:Tim17 249 370 1.1e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000117852
SMART Domains Protein: ENSMUSP00000114097
Gene: ENSMUSG00000039428

DomainStartEndE-ValueType
low complexity region 52 65 N/A INTRINSIC
transmembrane domain 67 89 N/A INTRINSIC
transmembrane domain 96 115 N/A INTRINSIC
transmembrane domain 147 169 N/A INTRINSIC
transmembrane domain 299 321 N/A INTRINSIC
transmembrane domain 331 353 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000117852
SMART Domains Protein: ENSMUSP00000114097
Gene: ENSMUSG00000039428

DomainStartEndE-ValueType
low complexity region 52 65 N/A INTRINSIC
transmembrane domain 67 89 N/A INTRINSIC
transmembrane domain 96 115 N/A INTRINSIC
transmembrane domain 147 169 N/A INTRINSIC
transmembrane domain 299 321 N/A INTRINSIC
transmembrane domain 331 353 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta2 G A 19: 34,252,531 T8I probably benign Het
Alox5 T C 6: 116,413,795 D465G possibly damaging Het
Arhgef16 T A 4: 154,282,882 K355N possibly damaging Het
C87499 A T 4: 88,630,042 I42N probably damaging Het
Camkk2 T A 5: 122,764,300 probably benign Het
Ccdc171 C T 4: 83,580,775 Q237* probably null Het
Ces2b T C 8: 104,837,385 Y464H possibly damaging Het
Cntfr A G 4: 41,662,013 F243S possibly damaging Het
Crip3 A T 17: 46,429,865 R65S probably benign Het
Dcn A G 10: 97,483,478 Y39C possibly damaging Het
Degs2 T C 12: 108,692,073 S216G possibly damaging Het
Dmxl1 A G 18: 49,902,794 I2295V probably benign Het
Dnah2 A G 11: 69,498,685 S794P probably damaging Het
Eri1 A C 8: 35,474,400 Y264* probably null Het
Etl4 T C 2: 20,713,378 L179P probably damaging Het
F5 T G 1: 164,186,912 M584R possibly damaging Het
Fam98c G T 7: 29,152,823 R104S probably damaging Het
Flad1 A T 3: 89,403,411 I443N probably benign Het
Hbp1 T C 12: 31,943,900 E43G probably benign Het
Hivep3 CGG CG 4: 120,097,911 probably null Het
Kcnj3 T A 2: 55,594,821 C310* probably null Het
Lct T C 1: 128,285,195 Y1907C probably damaging Het
Loxhd1 T C 18: 77,431,186 V1896A possibly damaging Het
Lrfn4 C A 19: 4,613,651 R285L probably damaging Het
Ltb4r2 T A 14: 55,762,881 S320T probably damaging Het
Mmd G T 11: 90,257,552 R20L probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Nbas T C 12: 13,558,660 S2146P probably benign Het
Nop14 A G 5: 34,651,791 F319L probably damaging Het
Numa1 C A 7: 101,999,423 T787K probably benign Het
Olfr1495 T G 19: 13,768,345 M1R probably null Het
Olfr325 A C 11: 58,581,173 T110P probably damaging Het
Olfr784 T G 10: 129,387,857 C75G possibly damaging Het
Patj T C 4: 98,546,987 V2A probably benign Het
Pisd T C 5: 32,740,688 H52R probably benign Het
Plekhg6 A T 6: 125,363,668 D576E probably benign Het
Plekhn1 T A 4: 156,225,653 H68L probably benign Het
Ppp1r37 T A 7: 19,561,853 I60F probably damaging Het
Ppp2r1b C T 9: 50,878,176 T513M possibly damaging Het
Rhobtb2 C A 14: 69,796,937 A280S probably damaging Het
Rnf40 A G 7: 127,589,875 D140G probably benign Het
Rxfp1 A G 3: 79,648,090 L653P probably damaging Het
Satb1 A T 17: 51,767,967 D500E probably benign Het
Slc15a1 A T 14: 121,475,965 D383E probably benign Het
Smarcad1 C A 6: 65,096,049 S604R possibly damaging Het
St7 A G 6: 17,934,217 T533A probably damaging Het
Sv2c T A 13: 95,985,943 T442S probably benign Het
Tbx2 A G 11: 85,840,796 T640A probably benign Het
Tenm4 T A 7: 96,893,014 N1948K probably damaging Het
Tll1 T C 8: 64,098,234 probably null Het
Tonsl A T 15: 76,633,936 L582Q probably null Het
Unc13c T A 9: 73,734,517 K1231N probably damaging Het
Vmn2r101 T A 17: 19,611,930 Y729* probably null Het
Zcchc2 A G 1: 106,001,012 T334A possibly damaging Het
Zfp655 T C 5: 145,237,107 L136P probably damaging Het
Zfp729a A T 13: 67,620,318 C597* probably null Het
Other mutations in Tmem135
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01459:Tmem135 APN 7 89151438 missense probably damaging 1.00
IGL01730:Tmem135 APN 7 89148044 missense possibly damaging 0.82
IGL01933:Tmem135 APN 7 89143857 unclassified probably benign
IGL02177:Tmem135 APN 7 89338453 missense probably damaging 1.00
IGL02305:Tmem135 APN 7 89165123 critical splice donor site probably null
IGL02747:Tmem135 APN 7 89144670 missense probably damaging 0.98
IGL02801:Tmem135 APN 7 89154125 missense probably benign 0.13
IGL03353:Tmem135 APN 7 89141953 missense probably damaging 1.00
skim UTSW 7 89196127 nonsense probably null
R0631:Tmem135 UTSW 7 89143788 nonsense probably null
R0657:Tmem135 UTSW 7 89144682 missense probably damaging 0.96
R2233:Tmem135 UTSW 7 89154074 missense probably damaging 1.00
R3118:Tmem135 UTSW 7 89147797 missense probably benign 0.02
R3119:Tmem135 UTSW 7 89147797 missense probably benign 0.02
R5094:Tmem135 UTSW 7 89143793 missense probably damaging 1.00
R5225:Tmem135 UTSW 7 89196127 nonsense probably null
R5248:Tmem135 UTSW 7 89147992 missense probably damaging 1.00
R5356:Tmem135 UTSW 7 89305515 missense probably benign 0.06
R5372:Tmem135 UTSW 7 89165174 splice site probably null
R5442:Tmem135 UTSW 7 89144664 missense probably damaging 1.00
R5789:Tmem135 UTSW 7 89196122 missense possibly damaging 0.73
R5863:Tmem135 UTSW 7 89147968 critical splice donor site probably null
R6158:Tmem135 UTSW 7 89156444 missense probably benign 0.12
R6383:Tmem135 UTSW 7 89144670 missense probably damaging 0.98
R6416:Tmem135 UTSW 7 89147794 missense probably benign
R6659:Tmem135 UTSW 7 89307163 missense probably benign 0.07
R6659:Tmem135 UTSW 7 89307164 nonsense probably null
R6731:Tmem135 UTSW 7 89243964 missense possibly damaging 0.96
R7545:Tmem135 UTSW 7 89305519 missense probably damaging 1.00
R8089:Tmem135 UTSW 7 89156495 missense probably damaging 0.99
R8447:Tmem135 UTSW 7 89154032 missense probably damaging 1.00
R8703:Tmem135 UTSW 7 89158962 missense not run
R8750:Tmem135 UTSW 7 89307248 missense probably damaging 0.99
R8758:Tmem135 UTSW 7 89305513 missense not run
R8806:Tmem135 UTSW 7 89147978 missense not run
R8807:Tmem135 UTSW 7 89147978 missense not run
R8808:Tmem135 UTSW 7 89147978 missense not run
Predicted Primers PCR Primer
(F):5'- TGGCAGCAGAACGATATGGTC -3'
(R):5'- AACACTCTTAGCTCTGCTTCTGTAG -3'

Sequencing Primer
(F):5'- GCAGCAGAACGATATGGTCTTTTC -3'
(R):5'- TTCTGTAGGTCCGACAGAAAGCTG -3'
Posted On2020-02-24