Mutagenetix > Incidental Mutations

Incidental Mutation 'R7626:Tll1'

628286

Institutional Source

Beutler Lab

Gene Symbol

Tll1

Ensembl Gene

ENSMUSG00000053626

Gene Name

tolloid-like

Synonyms

Tll-1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7626 (G1)

Quality Score

152.008

Status

Validated

Chromosome

Chromosomal Location

64014931-64206271 bp(-) (GRCm38)

Type of Mutation

splice site (195 bp from exon)

DNA Base Change (assembly)

T to C at 64098234 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000070560 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000066166]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000066166

SMART Domains

Protein: ENSMUSP00000070560
Gene: ENSMUSG00000053626

Domain	Start	End	E-Value	Type
ZnMc	153	295	4.12e-56	SMART
CUB	349	461	4.12e-44	SMART
CUB	462	574	3.81e-48	SMART
EGF_CA	574	615	2.28e-9	SMART
CUB	618	730	9.11e-46	SMART
EGF_CA	730	770	4.25e-9	SMART
CUB	774	886	2.01e-47	SMART
CUB	887	1003	7.19e-35	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

100% (56/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an astacin-like, zinc-dependent, metalloprotease that belongs to the peptidase M12A family. This protease processes procollagen C-propeptides, such as chordin, pro-biglycan and pro-lysyl oxidase. Studies in mice suggest that this gene plays multiple roles in the development of mammalian heart, and is essential for the formation of the interventricular septum. Allelic variants of this gene are associated with atrial septal defect type 6. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2011]
PHENOTYPE: Homozygous null mice are embryonic lethal with death at midgestation from cardiac failure. Cardiac defects include incomplete formation of the ventricular septum and abnormal positioning of the heart and aorta. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acta2	G	A	19: 34,252,531	T8I	probably benign	Het
Alox5	T	C	6: 116,413,795	D465G	possibly damaging	Het
Arhgef16	T	A	4: 154,282,882	K355N	possibly damaging	Het
C87499	A	T	4: 88,630,042	I42N	probably damaging	Het
Camkk2	T	A	5: 122,764,300		probably benign	Het
Ccdc171	C	T	4: 83,580,775	Q237*	probably null	Het
Ces2b	T	C	8: 104,837,385	Y464H	possibly damaging	Het
Cntfr	A	G	4: 41,662,013	F243S	possibly damaging	Het
Crip3	A	T	17: 46,429,865	R65S	probably benign	Het
Dcn	A	G	10: 97,483,478	Y39C	possibly damaging	Het
Degs2	T	C	12: 108,692,073	S216G	possibly damaging	Het
Dmxl1	A	G	18: 49,902,794	I2295V	probably benign	Het
Dnah2	A	G	11: 69,498,685	S794P	probably damaging	Het
Eri1	A	C	8: 35,474,400	Y264*	probably null	Het
Etl4	T	C	2: 20,713,378	L179P	probably damaging	Het
F5	T	G	1: 164,186,912	M584R	possibly damaging	Het
Fam98c	G	T	7: 29,152,823	R104S	probably damaging	Het
Flad1	A	T	3: 89,403,411	I443N	probably benign	Het
Hbp1	T	C	12: 31,943,900	E43G	probably benign	Het
Hivep3	CGG	CG	4: 120,097,911	1141	probably null	Het
Kcnj3	T	A	2: 55,594,821	C310*	probably null	Het
Lct	T	C	1: 128,285,195	Y1907C	probably damaging	Het
Loxhd1	T	C	18: 77,431,186	V1896A	possibly damaging	Het
Lrfn4	C	A	19: 4,613,651	R285L	probably damaging	Het
Ltb4r2	T	A	14: 55,762,881	S320T	probably damaging	Het
Mmd	G	T	11: 90,257,552	R20L	probably damaging	Het
Mmp1a	TG	TGG	9: 7,465,083		probably null	Het
Nbas	T	C	12: 13,558,660	S2146P	probably benign	Het
Nop14	A	G	5: 34,651,791	F319L	probably damaging	Het
Numa1	C	A	7: 101,999,423	T787K	probably benign	Het
Olfr1495	T	G	19: 13,768,345	M1R	probably null	Het
Olfr325	A	C	11: 58,581,173	T110P	probably damaging	Het
Olfr784	T	G	10: 129,387,857	C75G	possibly damaging	Het
Patj	T	C	4: 98,546,987	V2A	probably benign	Het
Pisd	T	C	5: 32,740,688	H52R	probably benign	Het
Plekhg6	A	T	6: 125,363,668	D576E	probably benign	Het
Plekhn1	T	A	4: 156,225,653	H68L	probably benign	Het
Ppp1r37	T	A	7: 19,561,853	I60F	probably damaging	Het
Ppp2r1b	C	T	9: 50,878,176	T513M	possibly damaging	Het
Rhobtb2	C	A	14: 69,796,937	A280S	probably damaging	Het
Rnf40	A	G	7: 127,589,875	D140G	probably benign	Het
Rxfp1	A	G	3: 79,648,090	L653P	probably damaging	Het
Satb1	A	T	17: 51,767,967	D500E	probably benign	Het
Slc15a1	A	T	14: 121,475,965	D383E	probably benign	Het
Smarcad1	C	A	6: 65,096,049	S604R	possibly damaging	Het
St7	A	G	6: 17,934,217	T533A	probably damaging	Het
Sv2c	T	A	13: 95,985,943	T442S	probably benign	Het
Tbx2	A	G	11: 85,840,796	T640A	probably benign	Het
Tenm4	T	A	7: 96,893,014	N1948K	probably damaging	Het
Tmem135	A	T	7: 89,156,510		probably null	Het
Tonsl	A	T	15: 76,633,936	L582Q	probably null	Het
Unc13c	T	A	9: 73,734,517	K1231N	probably damaging	Het
Vmn2r101	T	A	17: 19,611,930	Y729*	probably null	Het
Zcchc2	A	G	1: 106,001,012	T334A	possibly damaging	Het
Zfp655	T	C	5: 145,237,107	L136P	probably damaging	Het
Zfp729a	A	T	13: 67,620,318	C597*	probably null	Het

Other mutations in Tll1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00163:Tll1	APN	8	64016136	missense	probably benign
IGL00583:Tll1	APN	8	64205292	missense	probably benign
IGL00767:Tll1	APN	8	64071321	missense	probably damaging	1.00
IGL01061:Tll1	APN	8	64038454	critical splice donor site	probably null
IGL01077:Tll1	APN	8	64070232	missense	probably benign	0.27
IGL01536:Tll1	APN	8	64074289	missense	probably damaging	1.00
IGL02137:Tll1	APN	8	64016098	missense	possibly damaging	0.73
IGL02168:Tll1	APN	8	64053967	missense	possibly damaging	0.50
IGL02378:Tll1	APN	8	64017626	nonsense	probably null
IGL02469:Tll1	APN	8	64070280	missense	probably benign	0.41
IGL02504:Tll1	APN	8	64070237	missense	possibly damaging	0.55
IGL02650:Tll1	APN	8	64046997	splice site	probably benign
IGL02937:Tll1	APN	8	64205285	nonsense	probably null
IGL03006:Tll1	APN	8	64074217	splice site	probably benign
R0518:Tll1	UTSW	8	64098471	missense	probably damaging	1.00
R0521:Tll1	UTSW	8	64098471	missense	probably damaging	1.00
R0541:Tll1	UTSW	8	64038452	splice site	probably null
R0612:Tll1	UTSW	8	64071310	missense	possibly damaging	0.91
R0690:Tll1	UTSW	8	64074290	missense	probably damaging	0.99
R0738:Tll1	UTSW	8	64101950	missense	probably damaging	1.00
R1454:Tll1	UTSW	8	64038490	missense	probably benign
R1619:Tll1	UTSW	8	64056273	missense	probably benign	0.25
R1625:Tll1	UTSW	8	64041442	missense	probably damaging	1.00
R1654:Tll1	UTSW	8	64117903	critical splice donor site	probably null
R1663:Tll1	UTSW	8	64017686	missense	probably benign	0.08
R1681:Tll1	UTSW	8	64085551	missense	possibly damaging	0.93
R1713:Tll1	UTSW	8	64101873	missense	probably damaging	0.99
R1908:Tll1	UTSW	8	64025107	missense	probably damaging	0.98
R2118:Tll1	UTSW	8	64085557	missense	probably benign	0.21
R2121:Tll1	UTSW	8	64085557	missense	probably benign	0.21
R2124:Tll1	UTSW	8	64085557	missense	probably benign	0.21
R2360:Tll1	UTSW	8	64051401	missense	probably damaging	1.00
R2396:Tll1	UTSW	8	64070290	nonsense	probably null
R3032:Tll1	UTSW	8	64098492	missense	probably damaging	0.96
R3115:Tll1	UTSW	8	64053866	missense	probably damaging	1.00
R3889:Tll1	UTSW	8	64205224	missense	possibly damaging	0.77
R4126:Tll1	UTSW	8	64118014	missense	possibly damaging	0.78
R4182:Tll1	UTSW	8	64041511	missense	probably damaging	1.00
R4572:Tll1	UTSW	8	64056309	missense	possibly damaging	0.81
R4677:Tll1	UTSW	8	64051377	missense	probably benign	0.31
R4811:Tll1	UTSW	8	64085473	missense	possibly damaging	0.72
R4904:Tll1	UTSW	8	64070199	missense	probably benign	0.00
R4992:Tll1	UTSW	8	64093944	missense	probably damaging	0.98
R5061:Tll1	UTSW	8	64053949	missense	probably damaging	0.99
R5078:Tll1	UTSW	8	64093887	missense	probably damaging	1.00
R5208:Tll1	UTSW	8	64051493	missense	probably damaging	0.99
R5283:Tll1	UTSW	8	64101966	missense	possibly damaging	0.68
R5399:Tll1	UTSW	8	64085488	missense	probably damaging	1.00
R5699:Tll1	UTSW	8	64117940	missense	probably damaging	0.98
R5986:Tll1	UTSW	8	64074263	missense	probably damaging	0.99
R6019:Tll1	UTSW	8	64041491	missense	possibly damaging	0.83
R6046:Tll1	UTSW	8	64053891	nonsense	probably null
R6083:Tll1	UTSW	8	64038586	splice site	probably null
R6125:Tll1	UTSW	8	64051487	missense	probably damaging	1.00
R6222:Tll1	UTSW	8	64098534	missense	probably benign	0.18
R6275:Tll1	UTSW	8	64051367	nonsense	probably null
R6508:Tll1	UTSW	8	64098460	missense	probably damaging	0.99
R6758:Tll1	UTSW	8	64041405	critical splice donor site	probably null
R6782:Tll1	UTSW	8	64071281	missense	probably benign	0.00
R6848:Tll1	UTSW	8	64098510	missense	probably damaging	0.99
R7057:Tll1	UTSW	8	64101881	missense	probably damaging	1.00
R7144:Tll1	UTSW	8	64124945	missense	possibly damaging	0.90
R7244:Tll1	UTSW	8	64025188	missense	probably benign	0.00
R7336:Tll1	UTSW	8	64025142	missense	probably damaging	0.98
R7373:Tll1	UTSW	8	64051357	missense	probably damaging	0.98
R7687:Tll1	UTSW	8	64121492	nonsense	probably null
R7699:Tll1	UTSW	8	64093954	missense	probably benign	0.00
R7700:Tll1	UTSW	8	64093954	missense	probably benign	0.00
R7765:Tll1	UTSW	8	64051449	missense	probably damaging	1.00
R7790:Tll1	UTSW	8	64025237	nonsense	probably null
R7954:Tll1	UTSW	8	64118534	missense	probably damaging	1.00
R8710:Tll1	UTSW	8	64124906	missense	possibly damaging	0.77
R8792:Tll1	UTSW	8	64085465	missense	probably damaging	1.00
R9134:Tll1	UTSW	8	64016167	missense	possibly damaging	0.91
R9444:Tll1	UTSW	8	64016089	missense	probably damaging	1.00
X0020:Tll1	UTSW	8	64017628	missense	probably damaging	0.97
Z1176:Tll1	UTSW	8	64047163	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTGCCATTTTCTTGCAACAGG -3'
(R):5'- TACGCCAGGAACACCTTCTC -3'

Sequencing Primer
(F):5'- TTCTTGCAACAGGGGAATCAC -3'
(R):5'- CAAGGTTGGAGTCTCAGGTTATACC -3'

Posted On

2020-02-24