Incidental Mutation 'R0715:Mrm1'
ID62829
Institutional Source Beutler Lab
Gene Symbol Mrm1
Ensembl Gene ENSMUSG00000018405
Gene Namemitochondrial rRNA methyltransferase 1
Synonyms
MMRRC Submission 038898-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.161) question?
Stock #R0715 (G1)
Quality Score135
Status Validated
Chromosome11
Chromosomal Location84813061-84819515 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 84814813 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000018549 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018549]
Predicted Effect probably benign
Transcript: ENSMUST00000018549
SMART Domains Protein: ENSMUSP00000018549
Gene: ENSMUSG00000018405

DomainStartEndE-ValueType
SpoU_sub_bind 49 127 3.31e-11 SMART
Pfam:SpoU_methylase 143 299 3.2e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139076
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144104
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency 98% (61/62)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,223,092 C1933S probably benign Het
4930438A08Rik A G 11: 58,288,350 Y170C probably damaging Het
Adcy2 C T 13: 68,888,042 V167I probably benign Het
Agl A G 3: 116,752,176 Y1324H probably damaging Het
Arhgef37 G T 18: 61,508,789 Q170K probably damaging Het
Asah2 A G 19: 32,016,776 S390P probably damaging Het
Atp8a1 A T 5: 67,774,725 H240Q probably benign Het
Btbd16 T A 7: 130,788,827 N151K probably damaging Het
Ccdc73 T A 2: 104,973,154 probably benign Het
Cecr2 G T 6: 120,758,198 M21I probably benign Het
Ckap2l T C 2: 129,285,716 T181A probably benign Het
Col4a3 T C 1: 82,652,158 probably benign Het
Dnah9 A G 11: 66,081,248 probably benign Het
Fat3 T C 9: 16,375,123 T1035A probably benign Het
Fzd8 A G 18: 9,212,947 T10A unknown Het
Gm11639 T C 11: 104,720,880 L516P possibly damaging Het
Gm9631 C A 11: 121,942,502 C636F probably damaging Het
Gp1ba A G 11: 70,640,788 probably benign Het
Gsk3a A G 7: 25,231,709 V277A probably damaging Het
H2-M1 T A 17: 36,670,228 probably benign Het
Hesx1 T A 14: 27,000,852 W45R probably damaging Het
Il23r T A 6: 67,486,333 M59L possibly damaging Het
Insc T A 7: 114,845,077 V433E probably benign Het
Itga8 T C 2: 12,191,242 probably benign Het
Kif13a T A 13: 46,812,823 E436V probably damaging Het
Liph A G 16: 21,995,350 F7S probably benign Het
Lpar2 T C 8: 69,824,173 V204A probably damaging Het
Lrfn4 T A 19: 4,612,640 probably null Het
Man2b2 A T 5: 36,826,058 D182E probably benign Het
Mmp27 T C 9: 7,581,155 probably benign Het
Mtx3 T C 13: 92,850,361 S271P probably damaging Het
Myh11 A T 16: 14,226,616 M641K possibly damaging Het
Necab2 A G 8: 119,470,931 D332G probably damaging Het
Ngfr A G 11: 95,574,239 I261T possibly damaging Het
Nrap T C 19: 56,357,325 E617G probably damaging Het
Obscn G T 11: 59,050,480 T4505K probably benign Het
Olfr884 G T 9: 38,047,827 V202L probably benign Het
Olfr983 A G 9: 40,092,511 Y148H probably damaging Het
Osbpl11 T A 16: 33,241,730 probably benign Het
Otof A G 5: 30,394,697 V301A probably damaging Het
Phf3 A T 1: 30,811,838 L1145Q probably damaging Het
Phospho2 T A 2: 69,796,196 I232N possibly damaging Het
Pomgnt2 T A 9: 121,982,061 K551N probably damaging Het
Ptchd3 A G 11: 121,831,158 T286A possibly damaging Het
Rnf213 A G 11: 119,441,150 D2396G probably damaging Het
Sh3pxd2b A G 11: 32,423,341 E836G possibly damaging Het
Simc1 G T 13: 54,525,655 M605I possibly damaging Het
Slc12a3 G A 8: 94,329,433 E66K possibly damaging Het
Spg11 T C 2: 122,084,983 N1060S probably benign Het
Supt5 A T 7: 28,329,037 W178R probably damaging Het
Tmem41a G T 16: 21,937,990 F126L probably benign Het
Ube2m T A 7: 13,037,626 Q35L probably benign Het
Usp33 A G 3: 152,380,574 D658G probably damaging Het
Vmn2r12 A T 5: 109,090,507 C456S probably benign Het
Vmn2r81 T A 10: 79,268,600 D352E probably damaging Het
Zfp516 A G 18: 82,987,263 Y764C probably damaging Het
Zswim7 A G 11: 62,276,647 probably benign Het
Other mutations in Mrm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0226:Mrm1 UTSW 11 84819170 missense possibly damaging 0.73
R0257:Mrm1 UTSW 11 84814823 splice site probably benign
R0381:Mrm1 UTSW 11 84818683 missense possibly damaging 0.91
R0563:Mrm1 UTSW 11 84814713 missense probably damaging 1.00
R1710:Mrm1 UTSW 11 84818692 missense probably damaging 1.00
R4402:Mrm1 UTSW 11 84819089 missense probably damaging 1.00
R4413:Mrm1 UTSW 11 84819228 missense possibly damaging 0.46
R5266:Mrm1 UTSW 11 84819260 missense possibly damaging 0.58
R5930:Mrm1 UTSW 11 84819192 missense probably damaging 1.00
R7833:Mrm1 UTSW 11 84818643 missense probably damaging 1.00
R7916:Mrm1 UTSW 11 84818643 missense probably damaging 1.00
X0017:Mrm1 UTSW 11 84814923 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- AGGGCACGCTTGCTTTACACAC -3'
(R):5'- GCACCAGCACATGGCATTTTCTTTC -3'

Sequencing Primer
(F):5'- aggggaggggaggggag -3'
(R):5'- TTCTAGGCCAAGGCCCAG -3'
Posted On2013-07-30