Incidental Mutation 'R7637:Pank1'
ID628291
Institutional Source Beutler Lab
Gene Symbol Pank1
Ensembl Gene ENSMUSG00000033610
Gene Namepantothenate kinase 1
SynonymsPank1a, Pank1, 4632412I06Rik, Pank1b, 5430426F23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #R7637 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location34810894-34879455 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to C at 34821988 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000108079 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036584] [ENSMUST00000112460]
Predicted Effect probably null
Transcript: ENSMUST00000036584
SMART Domains Protein: ENSMUSP00000043562
Gene: ENSMUSG00000033610

DomainStartEndE-ValueType
low complexity region 16 29 N/A INTRINSIC
low complexity region 42 53 N/A INTRINSIC
low complexity region 135 147 N/A INTRINSIC
Pfam:Fumble 188 540 1.6e-121 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000112460
SMART Domains Protein: ENSMUSP00000108079
Gene: ENSMUSG00000033610

DomainStartEndE-ValueType
Pfam:Fumble 13 365 3.8e-122 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the pantothenate kinase family. Pantothenate kinases are key regulatory enzymes in the biosynthesis of coenzyme A (CoA). The encoded protein catalyzes the first and rate-limiting enzymatic reaction in CoA biosynthesis and is regulated by CoA through feedback inhibition. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. This gene and an intronic miRNA on the same strand are co-regulated by the tumor suppressor p53 (see PMID 20833636). [provided by RefSeq, Apr 2011]
PHENOTYPE: Homozygous mutant has increased body weight, polyphagia, decreased serum triglyceride and glucose levels after fasting. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T A 11: 110,218,952 Q651L probably benign Het
Adam8 C T 7: 139,985,430 V624I probably damaging Het
Ccdc144b T A 3: 36,046,876 Q49L probably damaging Het
Cltc T C 11: 86,730,332 H287R probably damaging Het
Cmya5 T C 13: 93,083,212 K3243R possibly damaging Het
Dock5 G A 14: 67,786,340 T1124M possibly damaging Het
Fam8a1 A T 13: 46,671,247 M237L probably benign Het
Fars2 G T 13: 36,204,775 K82N probably benign Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Gm5767 C T 16: 8,683,646 P59L unknown Het
Gnat3 A G 5: 18,003,772 D158G Het
Grhl2 A C 15: 37,328,330 N400T probably damaging Het
Grin2c A T 11: 115,256,259 probably null Het
Hipk4 A G 7: 27,523,548 Y11C probably damaging Het
Hspa9 G T 18: 34,938,687 A620E not run Het
Igkv12-89 A G 6: 68,835,099 S29P probably benign Het
Itga8 A T 2: 12,109,187 D1039E probably damaging Het
Itgae A T 11: 73,113,631 D248V probably damaging Het
Kmt2c T C 5: 25,315,095 K2006E probably damaging Het
Mdga1 C T 17: 29,832,379 G934R probably benign Het
Mov10 T C 3: 104,795,885 N896S probably benign Het
Ndufb6 A T 4: 40,273,080 probably null Het
Nlk T C 11: 78,591,005 probably null Het
Notch2 T A 3: 98,146,623 S2201T probably damaging Het
Olfr152 A T 2: 87,783,434 D298V probably damaging Het
Pdlim3 T C 8: 45,909,065 F126S probably damaging Het
Pds5a C A 5: 65,638,604 G648C probably benign Het
Plekhh3 T C 11: 101,164,327 I567V unknown Het
Ppfia2 T C 10: 106,865,403 probably null Het
Prl3d1 A G 13: 27,100,069 D207G probably damaging Het
Prss23 T A 7: 89,510,246 D205V probably benign Het
Pygl C T 12: 70,197,795 probably null Het
Qsox2 A G 2: 26,221,020 F111S probably damaging Het
Sart3 T C 5: 113,771,352 N95S probably benign Het
Scpep1 A G 11: 88,929,220 F414S probably damaging Het
Selenbp1 C A 3: 94,937,348 Y105* probably null Het
Sirpa A G 2: 129,616,445 D327G probably benign Het
Sowahc G A 10: 59,222,183 R47H probably damaging Het
Szt2 T C 4: 118,393,828 Y361C probably damaging Het
Taf3 A G 2: 9,940,993 V600A probably benign Het
Tie1 T C 4: 118,472,978 I1042M probably damaging Het
Tmem132e T A 11: 82,434,516 L114Q probably damaging Het
Tmx3 A G 18: 90,537,109 T317A probably damaging Het
Tppp3 A G 8: 105,468,292 V69A probably benign Het
Tpr T C 1: 150,423,516 Y1156H probably damaging Het
Trank1 A C 9: 111,365,296 D796A possibly damaging Het
Tsc2 G A 17: 24,607,492 P928S probably benign Het
Unc80 G T 1: 66,672,684 V2722F possibly damaging Het
Vmn1r199 G T 13: 22,382,675 L46F probably benign Het
Vps13a A T 19: 16,750,149 H196Q probably benign Het
Wnt10a T A 1: 74,793,474 C75* probably null Het
Zfp335 A G 2: 164,892,539 probably null Het
Other mutations in Pank1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01688:Pank1 APN 19 34840852 missense probably damaging 1.00
IGL02266:Pank1 APN 19 34813686 splice site probably benign
IGL02814:Pank1 APN 19 34840855 missense probably damaging 1.00
IGL03029:Pank1 APN 19 34821135 missense probably damaging 0.96
PIT4402001:Pank1 UTSW 19 34840966 missense probably damaging 1.00
R0388:Pank1 UTSW 19 34821706 splice site probably benign
R1254:Pank1 UTSW 19 34840860 missense probably benign 0.16
R1820:Pank1 UTSW 19 34877684 critical splice donor site probably null
R1928:Pank1 UTSW 19 34878881 missense probably benign
R2117:Pank1 UTSW 19 34841086 missense probably damaging 1.00
R2141:Pank1 UTSW 19 34878980 missense possibly damaging 0.91
R2147:Pank1 UTSW 19 34827354 missense probably benign 0.12
R2226:Pank1 UTSW 19 34827363 missense probably damaging 1.00
R4363:Pank1 UTSW 19 34827132 missense probably damaging 1.00
R4376:Pank1 UTSW 19 34877704 missense probably benign
R5081:Pank1 UTSW 19 34878916 missense probably benign
R5172:Pank1 UTSW 19 34840802 nonsense probably null
R6706:Pank1 UTSW 19 34812386 missense probably damaging 1.00
R6811:Pank1 UTSW 19 34841022 missense probably benign 0.37
R7957:Pank1 UTSW 19 34813696 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTAGCTGCCATGTCCAGAGC -3'
(R):5'- CACTTAGGCTAGTAGCTGGCTG -3'

Sequencing Primer
(F):5'- CATGTCCAGAGCTTCTTCAAAGG -3'
(R):5'- TAGCTGGCTGAAGGTCTCACAAC -3'
Posted On2020-02-24