Mutagenetix > Incidental Mutation

Incidental Mutation 'R7607:Ino80'

628295

Institutional Source

Beutler Lab

Gene Symbol

Ino80

Ensembl Gene

ENSMUSG00000034154

Gene Name

INO80 complex subunit

Synonyms

INO80, 2310079N15Rik, 4632409L19Rik, Inoc1

MMRRC Submission

045677-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.960) question?

Stock #

R7607 (G1)

Quality Score

95.0077

Status

Validated

Chromosome

Chromosomal Location

119373042-119477687 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to T at 119382269 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000051845 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049920]

AlphaFold

Q6ZPV2

Predicted Effect

probably null
Transcript: ENSMUST00000049920

SMART Domains

Protein: ENSMUSP00000051845
Gene: ENSMUSG00000034154

Domain	Start	End	E-Value	Type
coiled coil region	131	165	N/A	INTRINSIC
low complexity region	206	242	N/A	INTRINSIC
Pfam:DBINO	275	407	6.6e-50	PFAM
low complexity region	474	489	N/A	INTRINSIC
DEXDc	516	714	6.27e-37	SMART
low complexity region	907	923	N/A	INTRINSIC
HELICc	1134	1217	2.86e-22	SMART
low complexity region	1270	1324	N/A	INTRINSIC
low complexity region	1357	1368	N/A	INTRINSIC
low complexity region	1424	1436	N/A	INTRINSIC
low complexity region	1438	1450	N/A	INTRINSIC
low complexity region	1457	1483	N/A	INTRINSIC
low complexity region	1510	1521	N/A	INTRINSIC

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

99% (69/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the chromatin remodeling complex, which is classified into subfamilies depending on sequence features apart from the conserved ATPase domain. This protein is the catalytic ATPase subunit of the INO80 chromatin remodeling complex, which is characterized by a DNA-binding domain. This protein is proposed to bind DNA and be recruited by the YY1 transcription factor to activate certain genes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Embryos homozygous for a knock-out allele die around E7.5 and show absence of anterior and distal visceral endoderm. Another null allele results in embryonic lethality by E13.5-E14.5 with severe growth retardation and developmental defects. Heterozygotes show defects in hindlimb extension reflex. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010K14Rik	A	T	11: 70,237,557	H30Q	probably damaging	Het
1700012P22Rik	T	A	4: 144,419,762	H107L	probably damaging	Het
A930009A15Rik	G	A	10: 115,581,989		probably null	Het
Abca7	T	C	10: 80,011,833	L1779P	probably damaging	Het
Aff1	G	A	5: 103,849,459	V1140I	possibly damaging	Het
Ano2	C	T	6: 125,712,419	A169V	probably damaging	Het
Atat1	T	C	17: 35,909,107	Y101C	possibly damaging	Het
Atp6v1c1	T	C	15: 38,683,011		probably null	Het
Atp7b	T	G	8: 22,011,506	K912T	probably damaging	Het
Ceacam14	T	C	7: 17,814,321	V112A	possibly damaging	Het
Cobll1	T	C	2: 65,095,857	N1119S	probably benign	Het
Csmd1	G	T	8: 15,918,331	Q3099K	possibly damaging	Het
Cyp3a25	A	G	5: 145,984,981	V381A	possibly damaging	Het
Dctn1	C	T	6: 83,195,069	R948*	probably null	Het
Dhrs3	A	G	4: 144,923,940	T219A	probably benign	Het
Epha7	C	T	4: 28,871,937	S422L	probably benign	Het
Esrp1	A	G	4: 11,384,449	V78A	probably damaging	Het
Evc2	A	G	5: 37,386,856	T650A	possibly damaging	Het
Exoc6b	T	A	6: 84,989,409	K194N	possibly damaging	Het
Fer1l6	G	A	15: 58,662,732	W1809*	probably null	Het
Frmd4a	T	A	2: 4,591,936	L156*	probably null	Het
Gk5	A	T	9: 96,153,210		probably null	Het
Gm3573	A	G	14: 42,189,750	F8L	probably benign	Het
Gm906	T	C	13: 50,250,260	E2G	possibly damaging	Het
Gm9767	G	A	10: 26,078,940	C130Y	unknown	Het
Grip2	T	C	6: 91,788,412	T30A	probably benign	Het
Gskip	C	A	12: 105,698,897	A65E	possibly damaging	Het
Gtf2e2	A	G	8: 33,776,465	R259G	probably benign	Het
Gucy1b2	T	A	14: 62,419,177	I244F	probably damaging	Het
Gxylt2	G	T	6: 100,798,190	V357L	possibly damaging	Het
Hivep3	CGG	CG	4: 120,097,911	1141	probably null	Het
Igdcc4	C	T	9: 65,133,758	P1024S	possibly damaging	Het
Knl1	T	C	2: 119,095,133	F1881S	possibly damaging	Het
Mbd6	T	C	10: 127,285,230	E518G	unknown	Het
Mlh1	A	G	9: 111,229,890	S689P	probably damaging	Het
Mmrn2	T	C	14: 34,398,940	I589T	possibly damaging	Het
Mtmr12	C	T	15: 12,257,708	Q291*	probably null	Het
Mup8	T	A	4: 60,222,035	I33F	probably benign	Het
Mylk	C	T	16: 34,894,814	P504L	probably benign	Het
Ntrk3	C	T	7: 78,250,873	A573T	probably benign	Het
Obscn	G	T	11: 58,998,265	S7560R	unknown	Het
Olfr24	A	G	9: 18,754,882	F251S	possibly damaging	Het
Olfr617	A	C	7: 103,584,930	T303P	probably damaging	Het
Pde1c	T	C	6: 56,150,628	T391A	probably damaging	Het
Pla2g4d	T	A	2: 120,288,976	H19L	probably benign	Het
Plce1	C	A	19: 38,524,752	A165E	probably benign	Het
Polr1a	T	C	6: 71,913,021	S75P	probably benign	Het
Psg21	T	C	7: 18,654,783	E128G	probably benign	Het
Radil	A	T	5: 142,494,795	M635K	probably damaging	Het
Radil	A	G	5: 142,506,613	I420T	probably damaging	Het
Rnase11	G	A	14: 51,049,572	T175I	probably damaging	Het
Robo1	C	T	16: 72,563,738	P13S		Het
Slc18a2	C	A	19: 59,284,358	A364D	probably benign	Het
Snph	C	T	2: 151,594,586	D141N	probably damaging	Het
Snrnp70	T	C	7: 45,392,264	K70R	possibly damaging	Het
Snx33	T	C	9: 56,926,713	D24G	probably benign	Het
Spag6	T	A	2: 18,731,962	D165E	possibly damaging	Het
Spata31	T	G	13: 64,921,592	L518R	probably damaging	Het
Sspo	G	A	6: 48,489,727	V4059M	probably damaging	Het
St6galnac2	T	C	11: 116,679,979	Y261C	probably damaging	Het
Stoml1	A	G	9: 58,256,658	R87G	probably damaging	Het
Suv39h2	T	C	2: 3,474,829	T40A	unknown	Het
Terb2	G	T	2: 122,186,475	G26W	probably damaging	Het
Tmem62	T	C	2: 120,996,440	I406T	probably benign	Het
Tnfrsf11a	G	A	1: 105,844,732	V582I	probably benign	Het
Tpsg1	G	T	17: 25,373,210	G86V	probably damaging	Het
Unc13c	T	C	9: 73,669,535	D1480G	probably damaging	Het
Urb1	CACTTAC	CAC	16: 90,772,573		probably benign	Het
Vmn1r48	C	A	6: 90,035,980	V288L	probably benign	Het
Vmn2r13	A	G	5: 109,173,640	V397A	probably damaging	Het
Vmn2r98	A	G	17: 19,067,308	N468D	possibly damaging	Het
Zfhx2	G	T	14: 55,066,231	T1432K	possibly damaging	Het
Zswim5	T	A	4: 116,986,742	D992E	possibly damaging	Het

Other mutations in Ino80

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01402:Ino80	APN	2	119456718	missense	possibly damaging	0.83
IGL01404:Ino80	APN	2	119456718	missense	possibly damaging	0.83
IGL01985:Ino80	APN	2	119433321	missense	probably damaging	0.99
IGL02039:Ino80	APN	2	119380073	missense	probably damaging	1.00
IGL02187:Ino80	APN	2	119445457	splice site	probably benign
IGL02726:Ino80	APN	2	119442483	missense	probably damaging	1.00
Chosen	UTSW	2	119382269	splice site	probably null
PIT4677001:Ino80	UTSW	2	119377545	missense	probably benign
R0004:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0004:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0057:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0113:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0114:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0115:Ino80	UTSW	2	119431016	missense	probably damaging	1.00
R0138:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0189:Ino80	UTSW	2	119379679	missense	probably benign	0.36
R0363:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0364:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0365:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0481:Ino80	UTSW	2	119431016	missense	probably damaging	1.00
R0532:Ino80	UTSW	2	119381983	missense	possibly damaging	0.79
R0580:Ino80	UTSW	2	119383481	missense	probably damaging	1.00
R0610:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0675:Ino80	UTSW	2	119383481	missense	probably damaging	1.00
R1275:Ino80	UTSW	2	119427055	missense	probably benign	0.12
R1470:Ino80	UTSW	2	119379649	missense	probably damaging	1.00
R1470:Ino80	UTSW	2	119379649	missense	probably damaging	1.00
R1506:Ino80	UTSW	2	119425265	nonsense	probably null
R1510:Ino80	UTSW	2	119450049	missense	probably damaging	1.00
R1570:Ino80	UTSW	2	119447028	missense	possibly damaging	0.68
R1613:Ino80	UTSW	2	119392867	missense	probably damaging	1.00
R1673:Ino80	UTSW	2	119381936	missense	probably damaging	1.00
R1773:Ino80	UTSW	2	119418409	missense	probably benign	0.18
R1795:Ino80	UTSW	2	119406859	missense	probably damaging	1.00
R2093:Ino80	UTSW	2	119426670	missense	possibly damaging	0.55
R2105:Ino80	UTSW	2	119431929	missense	probably null	1.00
R2113:Ino80	UTSW	2	119454084	missense	probably damaging	1.00
R3618:Ino80	UTSW	2	119446872	missense	probably null	0.81
R4572:Ino80	UTSW	2	119402358	missense	probably damaging	1.00
R4649:Ino80	UTSW	2	119431008	missense	probably damaging	1.00
R4919:Ino80	UTSW	2	119442592	missense	probably damaging	1.00
R5113:Ino80	UTSW	2	119431945	missense	probably damaging	1.00
R5138:Ino80	UTSW	2	119383421	missense	probably damaging	1.00
R5458:Ino80	UTSW	2	119412429	missense	possibly damaging	0.50
R5499:Ino80	UTSW	2	119441647	missense	probably damaging	1.00
R5502:Ino80	UTSW	2	119402396	missense	probably damaging	1.00
R5531:Ino80	UTSW	2	119445575	missense	probably benign
R5740:Ino80	UTSW	2	119431029	missense	probably damaging	1.00
R5892:Ino80	UTSW	2	119439547	intron	probably benign
R5914:Ino80	UTSW	2	119458216	missense	probably damaging	0.99
R6000:Ino80	UTSW	2	119374508	missense	probably benign	0.04
R6263:Ino80	UTSW	2	119383414	missense	probably damaging	1.00
R6505:Ino80	UTSW	2	119451441	missense	probably damaging	1.00
R6942:Ino80	UTSW	2	119383502	missense	probably damaging	0.99
R7052:Ino80	UTSW	2	119426587	critical splice donor site	probably null
R7100:Ino80	UTSW	2	119374513	missense	possibly damaging	0.47
R7163:Ino80	UTSW	2	119392875	missense	probably damaging	1.00
R7187:Ino80	UTSW	2	119426591	missense	probably benign	0.00
R7202:Ino80	UTSW	2	119374437	missense	probably benign	0.00
R7218:Ino80	UTSW	2	119458127	missense	probably benign
R7389:Ino80	UTSW	2	119442529	missense	probably benign	0.00
R7419:Ino80	UTSW	2	119380014	missense	probably benign	0.00
R7437:Ino80	UTSW	2	119442586	missense	possibly damaging	0.86
R7702:Ino80	UTSW	2	119442573	missense	probably benign	0.01
R7975:Ino80	UTSW	2	119456467	splice site	probably null
R7978:Ino80	UTSW	2	119439393	missense	possibly damaging	0.93
R8376:Ino80	UTSW	2	119442487	missense	probably benign	0.14
R8469:Ino80	UTSW	2	119379593	missense	probably benign
R8720:Ino80	UTSW	2	119402387	missense	probably damaging	1.00
R8751:Ino80	UTSW	2	119406908	missense	probably benign
R8958:Ino80	UTSW	2	119383381	missense	probably damaging	1.00
R8992:Ino80	UTSW	2	119379578	missense	possibly damaging	0.93
R9319:Ino80	UTSW	2	119374524	missense	probably benign	0.13
R9346:Ino80	UTSW	2	119426958	missense	possibly damaging	0.54
R9370:Ino80	UTSW	2	119402367	missense	probably damaging	1.00
R9621:Ino80	UTSW	2	119450015	missense	probably damaging	0.98
R9641:Ino80	UTSW	2	119445484	missense	probably benign	0.08
R9650:Ino80	UTSW	2	119446983	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCTCTTGTGGTTGGTTCCCAAG -3'
(R):5'- CCTGAGTTCCTGTGAGTACTTC -3'

Sequencing Primer
(F):5'- TGGTTCCCAAGGTGTAATTTTTG -3'
(R):5'- GTACTTCCTCACCTCTACATCTAAAC -3'

Posted On

2020-02-27