Incidental Mutation 'R7607:Gk5'
ID 628296
Institutional Source Beutler Lab
Gene Symbol Gk5
Ensembl Gene ENSMUSG00000041440
Gene Name glycerol kinase 5
Synonyms G630067D24Rik, C330018K18Rik
MMRRC Submission 045677-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7607 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 96001415-96066661 bp(+) (GRCm39)
Type of Mutation splice site (3 bp from exon)
DNA Base Change (assembly) A to T at 96035263 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000112717 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085217] [ENSMUST00000122383] [ENSMUST00000129774]
AlphaFold Q8BX05
Predicted Effect probably null
Transcript: ENSMUST00000085217
SMART Domains Protein: ENSMUSP00000082313
Gene: ENSMUSG00000041440

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
Pfam:FGGY_N 25 287 9e-50 PFAM
Pfam:FGGY_C 296 485 7.7e-35 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000122383
SMART Domains Protein: ENSMUSP00000112717
Gene: ENSMUSG00000041440

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
Pfam:FGGY_N 25 287 1.9e-49 PFAM
Pfam:FGGY_C 296 485 1.8e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129774
SMART Domains Protein: ENSMUSP00000123594
Gene: ENSMUSG00000041440

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
SCOP:d1bu6o1 24 56 1e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 99% (69/70)
MGI Phenotype PHENOTYPE: Homozygous knockout does not result in an obvious skin phenotype and does not lead to alopecia. [provided by MGI curators]
Allele List at MGI

All alleles(19) : Targeted(2) Gene trapped(17)

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010K14Rik A T 11: 70,128,383 (GRCm39) H30Q probably damaging Het
A930009A15Rik G A 10: 115,417,894 (GRCm39) probably null Het
Abca7 T C 10: 79,847,667 (GRCm39) L1779P probably damaging Het
Aff1 G A 5: 103,997,325 (GRCm39) V1140I possibly damaging Het
Ano2 C T 6: 125,689,382 (GRCm39) A169V probably damaging Het
Atat1 T C 17: 36,219,999 (GRCm39) Y101C possibly damaging Het
Atp6v1c1 T C 15: 38,683,255 (GRCm39) probably null Het
Atp7b T G 8: 22,501,522 (GRCm39) K912T probably damaging Het
Ceacam14 T C 7: 17,548,246 (GRCm39) V112A possibly damaging Het
Cfap107 T A 4: 144,146,332 (GRCm39) H107L probably damaging Het
Cobll1 T C 2: 64,926,201 (GRCm39) N1119S probably benign Het
Csmd1 G T 8: 15,968,331 (GRCm39) Q3099K possibly damaging Het
Cyp3a25 A G 5: 145,921,791 (GRCm39) V381A possibly damaging Het
Dctn1 C T 6: 83,172,051 (GRCm39) R948* probably null Het
Dhrs3 A G 4: 144,650,510 (GRCm39) T219A probably benign Het
Epha7 C T 4: 28,871,937 (GRCm39) S422L probably benign Het
Esrp1 A G 4: 11,384,449 (GRCm39) V78A probably damaging Het
Evc2 A G 5: 37,544,200 (GRCm39) T650A possibly damaging Het
Exoc6b T A 6: 84,966,391 (GRCm39) K194N possibly damaging Het
Fer1l6 G A 15: 58,534,581 (GRCm39) W1809* probably null Het
Frmd4a T A 2: 4,596,747 (GRCm39) L156* probably null Het
Gm3573 A G 14: 42,011,707 (GRCm39) F8L probably benign Het
Gm9767 G A 10: 25,954,838 (GRCm39) C130Y unknown Het
Grip2 T C 6: 91,765,393 (GRCm39) T30A probably benign Het
Gskip C A 12: 105,665,156 (GRCm39) A65E possibly damaging Het
Gtf2e2 A G 8: 34,266,493 (GRCm39) R259G probably benign Het
Gucy1b2 T A 14: 62,656,626 (GRCm39) I244F probably damaging Het
Gxylt2 G T 6: 100,775,151 (GRCm39) V357L possibly damaging Het
Hivep3 CGG CG 4: 119,955,108 (GRCm39) 1141 probably null Het
Igdcc4 C T 9: 65,041,040 (GRCm39) P1024S possibly damaging Het
Ino80 A T 2: 119,212,750 (GRCm39) probably null Het
Knl1 T C 2: 118,925,614 (GRCm39) F1881S possibly damaging Het
Mbd6 T C 10: 127,121,099 (GRCm39) E518G unknown Het
Mlh1 A G 9: 111,058,958 (GRCm39) S689P probably damaging Het
Mmrn2 T C 14: 34,120,897 (GRCm39) I589T possibly damaging Het
Mtmr12 C T 15: 12,257,794 (GRCm39) Q291* probably null Het
Mup8 T A 4: 60,222,035 (GRCm39) I33F probably benign Het
Mylk C T 16: 34,715,184 (GRCm39) P504L probably benign Het
Ntrk3 C T 7: 77,900,621 (GRCm39) A573T probably benign Het
Obscn G T 11: 58,889,091 (GRCm39) S7560R unknown Het
Or1m1 A G 9: 18,666,178 (GRCm39) F251S possibly damaging Het
Or52z12 A C 7: 103,234,137 (GRCm39) T303P probably damaging Het
Pde1c T C 6: 56,127,613 (GRCm39) T391A probably damaging Het
Pla2g4d T A 2: 120,119,457 (GRCm39) H19L probably benign Het
Plce1 C A 19: 38,513,196 (GRCm39) A165E probably benign Het
Polr1a T C 6: 71,890,005 (GRCm39) S75P probably benign Het
Psg21 T C 7: 18,388,708 (GRCm39) E128G probably benign Het
Radil A T 5: 142,480,550 (GRCm39) M635K probably damaging Het
Radil A G 5: 142,492,368 (GRCm39) I420T probably damaging Het
Rnase11 G A 14: 51,287,029 (GRCm39) T175I probably damaging Het
Robo1 C T 16: 72,360,626 (GRCm39) P13S Het
Slc18a2 C A 19: 59,272,790 (GRCm39) A364D probably benign Het
Snph C T 2: 151,436,506 (GRCm39) D141N probably damaging Het
Snrnp70 T C 7: 45,041,688 (GRCm39) K70R possibly damaging Het
Snx33 T C 9: 56,833,997 (GRCm39) D24G probably benign Het
Spag6 T A 2: 18,736,773 (GRCm39) D165E possibly damaging Het
Spata31 T G 13: 65,069,406 (GRCm39) L518R probably damaging Het
Spata31e3 T C 13: 50,404,296 (GRCm39) E2G possibly damaging Het
Sspo G A 6: 48,466,661 (GRCm39) V4059M probably damaging Het
St6galnac2 T C 11: 116,570,805 (GRCm39) Y261C probably damaging Het
Stoml1 A G 9: 58,163,941 (GRCm39) R87G probably damaging Het
Suv39h2 T C 2: 3,475,866 (GRCm39) T40A unknown Het
Terb2 G T 2: 122,016,956 (GRCm39) G26W probably damaging Het
Tmem62 T C 2: 120,826,921 (GRCm39) I406T probably benign Het
Tnfrsf11a G A 1: 105,772,458 (GRCm39) V582I probably benign Het
Tpsg1 G T 17: 25,592,184 (GRCm39) G86V probably damaging Het
Unc13c T C 9: 73,576,817 (GRCm39) D1480G probably damaging Het
Urb1 CACTTAC CAC 16: 90,569,461 (GRCm39) probably benign Het
Vmn1r48 C A 6: 90,012,962 (GRCm39) V288L probably benign Het
Vmn2r13 A G 5: 109,321,506 (GRCm39) V397A probably damaging Het
Vmn2r98 A G 17: 19,287,570 (GRCm39) N468D possibly damaging Het
Zfhx2 G T 14: 55,303,688 (GRCm39) T1432K possibly damaging Het
Zswim5 T A 4: 116,843,939 (GRCm39) D992E possibly damaging Het
Other mutations in Gk5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01359:Gk5 APN 9 96,019,842 (GRCm39) missense probably damaging 0.98
IGL01387:Gk5 APN 9 96,059,607 (GRCm39) critical splice donor site probably null
IGL01771:Gk5 APN 9 96,059,488 (GRCm39) missense probably damaging 0.97
IGL02253:Gk5 APN 9 96,019,824 (GRCm39) missense probably damaging 1.00
IGL02380:Gk5 APN 9 96,032,533 (GRCm39) missense possibly damaging 0.92
IGL02566:Gk5 APN 9 96,011,099 (GRCm39) missense possibly damaging 0.56
IGL03137:Gk5 APN 9 96,058,345 (GRCm39) splice site probably benign
IGL03256:Gk5 APN 9 96,011,106 (GRCm39) missense probably damaging 1.00
IGL03326:Gk5 APN 9 96,019,892 (GRCm39) critical splice donor site probably null
barrener UTSW 9 96,011,149 (GRCm39) critical splice donor site probably null
glimpse UTSW 9 96,063,823 (GRCm39) critical splice acceptor site probably null
homer UTSW 9 96,022,709 (GRCm39) nonsense probably null
sean UTSW 9 96,058,290 (GRCm39) nonsense probably null
stripped UTSW 9 96,011,106 (GRCm39) missense probably damaging 1.00
tangyuan UTSW 9 96,032,850 (GRCm39) critical splice donor site probably null
toku UTSW 9 96,022,682 (GRCm39) frame shift probably null
victoria UTSW 9 96,032,839 (GRCm39) missense possibly damaging 0.65
G1patch:Gk5 UTSW 9 96,037,523 (GRCm39) missense probably benign 0.01
I1329:Gk5 UTSW 9 96,022,682 (GRCm39) frame shift probably null
R0279:Gk5 UTSW 9 96,056,857 (GRCm39) splice site probably benign
R0284:Gk5 UTSW 9 96,063,823 (GRCm39) critical splice acceptor site probably null
R1134:Gk5 UTSW 9 96,015,460 (GRCm39) missense probably benign 0.00
R1184:Gk5 UTSW 9 96,032,473 (GRCm39) splice site probably benign
R1772:Gk5 UTSW 9 96,032,850 (GRCm39) critical splice donor site probably null
R1781:Gk5 UTSW 9 96,015,508 (GRCm39) missense possibly damaging 0.79
R3691:Gk5 UTSW 9 96,011,149 (GRCm39) critical splice donor site probably null
R4213:Gk5 UTSW 9 96,011,106 (GRCm39) missense probably damaging 1.00
R5015:Gk5 UTSW 9 96,059,470 (GRCm39) critical splice acceptor site probably null
R5166:Gk5 UTSW 9 96,056,821 (GRCm39) missense probably damaging 0.99
R5643:Gk5 UTSW 9 96,022,709 (GRCm39) nonsense probably null
R5857:Gk5 UTSW 9 96,001,508 (GRCm39) nonsense probably null
R5924:Gk5 UTSW 9 96,032,563 (GRCm39) critical splice donor site probably null
R6109:Gk5 UTSW 9 96,022,663 (GRCm39) missense probably benign 0.00
R6138:Gk5 UTSW 9 96,058,290 (GRCm39) nonsense probably null
R6725:Gk5 UTSW 9 96,037,523 (GRCm39) missense probably benign 0.01
R6812:Gk5 UTSW 9 96,032,802 (GRCm39) missense probably damaging 0.99
R7065:Gk5 UTSW 9 96,061,109 (GRCm39) missense probably damaging 1.00
R7182:Gk5 UTSW 9 96,001,579 (GRCm39) missense possibly damaging 0.89
R7213:Gk5 UTSW 9 96,027,765 (GRCm39) missense probably damaging 1.00
R7260:Gk5 UTSW 9 96,001,663 (GRCm39) missense probably benign 0.10
R7666:Gk5 UTSW 9 96,035,160 (GRCm39) missense probably damaging 1.00
R8152:Gk5 UTSW 9 96,056,756 (GRCm39) missense probably damaging 1.00
R8355:Gk5 UTSW 9 96,032,839 (GRCm39) missense possibly damaging 0.65
R8954:Gk5 UTSW 9 96,059,562 (GRCm39) missense probably benign 0.07
R9077:Gk5 UTSW 9 96,001,634 (GRCm39) missense probably benign 0.00
R9186:Gk5 UTSW 9 96,015,469 (GRCm39) missense probably benign 0.44
U15987:Gk5 UTSW 9 96,058,290 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCAGGGTACAGTGTGTTTCTGAC -3'
(R):5'- GCCAAATCCATCTGTTAATTTGCTG -3'

Sequencing Primer
(F):5'- ACAGTGTGTTTCTGACAGTCTGAC -3'
(R):5'- ACTTGCTCTGTAGAACAGGC -3'
Posted On 2020-02-27