Incidental Mutation 'R7621:Lce1m'
ID628298
Institutional Source Beutler Lab
Gene Symbol Lce1m
Ensembl Gene ENSMUSG00000027912
Gene Namelate cornified envelope 1M
SynonymsSprrl10, Lce5a, 1110059L13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Not available question?
Stock #R7621 (G1)
Quality Score89.0077
Status Validated
Chromosome3
Chromosomal Location93017810-93019060 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 93017870 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000029520 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029520] [ENSMUST00000029521] [ENSMUST00000107301] [ENSMUST00000193944]
Predicted Effect probably null
Transcript: ENSMUST00000029520
SMART Domains Protein: ENSMUSP00000029520
Gene: ENSMUSG00000027912

DomainStartEndE-ValueType
Pfam:LCE 9 96 5.4e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000029521
SMART Domains Protein: ENSMUSP00000029521
Gene: ENSMUSG00000027913

DomainStartEndE-ValueType
low complexity region 12 102 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107301
SMART Domains Protein: ENSMUSP00000102922
Gene: ENSMUSG00000027913

DomainStartEndE-ValueType
Pfam:NICE-1 5 100 5.4e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193944
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (45/45)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik G A 7: 140,296,829 G711D probably damaging Het
Abca9 T A 11: 110,160,533 K112N probably benign Het
Brwd1 A G 16: 96,064,887 S232P probably damaging Het
Calm5 A T 13: 3,854,629 M108L possibly damaging Het
Ces1g A T 8: 93,328,466 V201D probably damaging Het
Cltc C A 11: 86,707,486 V1017L probably benign Het
Cpt1c C T 7: 44,967,092 R245Q probably damaging Het
Csrnp1 C A 9: 119,977,092 A39S probably benign Het
Elf1 A G 14: 79,570,882 D258G possibly damaging Het
Fam189a2 A C 19: 23,994,804 S179A possibly damaging Het
Glipr1l1 A T 10: 112,060,395 D29V probably benign Het
Gm4340 T C 10: 104,195,959 V188A probably benign Het
Gsdma2 T C 11: 98,649,549 M98T probably benign Het
Hars A T 18: 36,770,423 D315E probably benign Het
Hsph1 A C 5: 149,632,075 Y89D probably damaging Het
Ighv11-2 T A 12: 114,048,388 D69V probably benign Het
Kirrel C T 3: 87,088,221 G438D possibly damaging Het
Krt6a G T 15: 101,691,752 T355K possibly damaging Het
Lmbrd1 A T 1: 24,728,544 probably null Het
Lmtk3 A G 7: 45,793,417 E508G probably damaging Het
Lrrc2 G A 9: 110,980,831 V312I probably benign Het
Lyn A T 4: 3,789,834 K477* probably null Het
Nfe2l2 T C 2: 75,679,413 D21G probably damaging Het
Olfr1316 T C 2: 112,130,581 T77A probably benign Het
Olfr297 G A 7: 86,527,072 C105Y probably benign Het
Olfr543 G A 7: 102,477,265 R202C possibly damaging Het
Olfr893 T C 9: 38,209,151 F31L probably benign Het
Pkm T A 9: 59,678,158 C474* probably null Het
Prr36 T A 8: 4,213,150 I839F unknown Het
Qtrt2 A G 16: 43,868,940 probably null Het
Ripk4 A T 16: 97,745,925 V379E probably damaging Het
Rreb1 C A 13: 37,949,066 P304Q Het
Saxo2 A T 7: 82,648,417 C5S possibly damaging Het
Sema5a C A 15: 32,609,232 T428N possibly damaging Het
Setd5 C A 6: 113,144,049 P1073Q possibly damaging Het
Sh2d5 T G 4: 138,256,839 C173G probably benign Het
Slc4a10 T G 2: 62,250,479 V350G probably damaging Het
Slco1a6 A G 6: 142,161,017 C15R probably damaging Het
Smg7 A T 1: 152,841,544 F940Y possibly damaging Het
Spata17 T A 1: 187,122,636 probably null Het
Specc1 A G 11: 62,128,384 N603S possibly damaging Het
Tbc1d1 A G 5: 64,264,330 D355G probably damaging Het
Thbs2 T C 17: 14,674,164 D807G probably benign Het
Tmem8 C A 17: 26,117,891 P261Q probably benign Het
Usp53 T C 3: 122,961,285 T174A probably benign Het
Vmn2r52 A G 7: 10,173,347 Y151H probably benign Het
Wdr12 G A 1: 60,097,589 probably benign Het
Other mutations in Lce1m
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4342:Lce1m UTSW 3 93018247 unclassified probably benign
FR4449:Lce1m UTSW 3 93018152 unclassified probably benign
FR4589:Lce1m UTSW 3 93018268 unclassified probably benign
FR4976:Lce1m UTSW 3 93018148 unclassified probably benign
R1513:Lce1m UTSW 3 93018625 unclassified probably benign
R7753:Lce1m UTSW 3 93018508 missense unknown
RF001:Lce1m UTSW 3 93018152 unclassified probably benign
RF001:Lce1m UTSW 3 93018269 unclassified probably benign
RF002:Lce1m UTSW 3 93018283 unclassified probably benign
RF002:Lce1m UTSW 3 93018299 unclassified probably benign
RF007:Lce1m UTSW 3 93018144 unclassified probably benign
RF009:Lce1m UTSW 3 93018131 unclassified probably benign
RF010:Lce1m UTSW 3 93018290 unclassified probably benign
RF015:Lce1m UTSW 3 93018148 unclassified probably benign
RF021:Lce1m UTSW 3 93018269 unclassified probably benign
RF021:Lce1m UTSW 3 93018295 unclassified probably benign
RF023:Lce1m UTSW 3 93018280 unclassified probably benign
RF026:Lce1m UTSW 3 93018138 unclassified probably benign
RF026:Lce1m UTSW 3 93018143 unclassified probably benign
RF028:Lce1m UTSW 3 93018131 unclassified probably benign
RF030:Lce1m UTSW 3 93018141 unclassified probably benign
RF030:Lce1m UTSW 3 93018344 unclassified probably benign
RF037:Lce1m UTSW 3 93018300 unclassified probably benign
RF041:Lce1m UTSW 3 93018141 unclassified probably benign
RF042:Lce1m UTSW 3 93018139 unclassified probably benign
RF045:Lce1m UTSW 3 93018292 unclassified probably benign
RF046:Lce1m UTSW 3 93018293 unclassified probably benign
RF054:Lce1m UTSW 3 93018298 unclassified probably benign
RF059:Lce1m UTSW 3 93018329 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CCTGTGCAAGTTGGTATAAGGG -3'
(R):5'- TTGACTGAAGACCTGCAAGC -3'

Sequencing Primer
(F):5'- GCCTCAGAGTACTAAGTTTTAAGTGG -3'
(R):5'- CTGAAGACCTGCAAGCCTAGG -3'
Posted On2020-02-27