Incidental Mutation 'R7621:Qtrt2'
ID628299
Institutional Source Beutler Lab
Gene Symbol Qtrt2
Ensembl Gene ENSMUSG00000022704
Gene Namequeuine tRNA-ribosyltransferase accessory subunit 2
Synonyms3110012M05Rik, 4930470H18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R7621 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location43861407-43926809 bp(-) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) A to G at 43868940 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000023387 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023387]
Predicted Effect probably null
Transcript: ENSMUST00000023387
SMART Domains Protein: ENSMUSP00000023387
Gene: ENSMUSG00000022704

DomainStartEndE-ValueType
Pfam:TGT 95 340 7.1e-59 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of tRNA-guanine transglycosylase. tRNA-guanine transglycosylase is a heterodimeric enzyme complex that plays a critical role in tRNA modification by synthesizing the 7-deazaguanosine queuosine, which is found in tRNAs that code for asparagine, aspartic acid, histidine, and tyrosine. The encoded protein may play a role in the queuosine 5'-monophosphate salvage pathway. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2012]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik G A 7: 140,296,829 G711D probably damaging Het
Abca9 T A 11: 110,160,533 K112N probably benign Het
Brwd1 A G 16: 96,064,887 S232P probably damaging Het
Calm5 A T 13: 3,854,629 M108L possibly damaging Het
Ces1g A T 8: 93,328,466 V201D probably damaging Het
Cltc C A 11: 86,707,486 V1017L probably benign Het
Cpt1c C T 7: 44,967,092 R245Q probably damaging Het
Csrnp1 C A 9: 119,977,092 A39S probably benign Het
Elf1 A G 14: 79,570,882 D258G possibly damaging Het
Fam189a2 A C 19: 23,994,804 S179A possibly damaging Het
Glipr1l1 A T 10: 112,060,395 D29V probably benign Het
Gm4340 T C 10: 104,195,959 V188A probably benign Het
Gsdma2 T C 11: 98,649,549 M98T probably benign Het
Hars A T 18: 36,770,423 D315E probably benign Het
Hsph1 A C 5: 149,632,075 Y89D probably damaging Het
Ighv11-2 T A 12: 114,048,388 D69V probably benign Het
Kirrel C T 3: 87,088,221 G438D possibly damaging Het
Krt6a G T 15: 101,691,752 T355K possibly damaging Het
Lce1m T C 3: 93,017,870 probably null Het
Lmbrd1 A T 1: 24,728,544 probably null Het
Lmtk3 A G 7: 45,793,417 E508G probably damaging Het
Lrrc2 G A 9: 110,980,831 V312I probably benign Het
Lyn A T 4: 3,789,834 K477* probably null Het
Nfe2l2 T C 2: 75,679,413 D21G probably damaging Het
Olfr1316 T C 2: 112,130,581 T77A probably benign Het
Olfr297 G A 7: 86,527,072 C105Y probably benign Het
Olfr543 G A 7: 102,477,265 R202C possibly damaging Het
Olfr893 T C 9: 38,209,151 F31L probably benign Het
Pkm T A 9: 59,678,158 C474* probably null Het
Prr36 T A 8: 4,213,150 I839F unknown Het
Ripk4 A T 16: 97,745,925 V379E probably damaging Het
Rreb1 C A 13: 37,949,066 P304Q Het
Saxo2 A T 7: 82,648,417 C5S possibly damaging Het
Sema5a C A 15: 32,609,232 T428N possibly damaging Het
Setd5 C A 6: 113,144,049 P1073Q possibly damaging Het
Sh2d5 T G 4: 138,256,839 C173G probably benign Het
Slc4a10 T G 2: 62,250,479 V350G probably damaging Het
Slco1a6 A G 6: 142,161,017 C15R probably damaging Het
Smg7 A T 1: 152,841,544 F940Y possibly damaging Het
Spata17 T A 1: 187,122,636 probably null Het
Specc1 A G 11: 62,128,384 N603S possibly damaging Het
Tbc1d1 A G 5: 64,264,330 D355G probably damaging Het
Thbs2 T C 17: 14,674,164 D807G probably benign Het
Tmem8 C A 17: 26,117,891 P261Q probably benign Het
Usp53 T C 3: 122,961,285 T174A probably benign Het
Vmn2r52 A G 7: 10,173,347 Y151H probably benign Het
Wdr12 G A 1: 60,097,589 probably benign Het
Other mutations in Qtrt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:Qtrt2 APN 16 43881189 missense probably damaging 0.99
R1018:Qtrt2 UTSW 16 43878000 missense possibly damaging 0.93
R1258:Qtrt2 UTSW 16 43869083 missense possibly damaging 0.77
R1499:Qtrt2 UTSW 16 43868974 missense probably benign 0.43
R1574:Qtrt2 UTSW 16 43871832 unclassified probably benign
R1830:Qtrt2 UTSW 16 43871655 missense probably damaging 1.00
R2013:Qtrt2 UTSW 16 43869092 missense probably damaging 1.00
R3835:Qtrt2 UTSW 16 43881072 missense probably damaging 1.00
R5199:Qtrt2 UTSW 16 43867425 missense probably benign 0.10
R7449:Qtrt2 UTSW 16 43881032 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- ACACATGCAGTATTGAGTTCCTTG -3'
(R):5'- TGTTGACCTGGAAGCATCC -3'

Sequencing Primer
(F):5'- GCTCTAGGTGCCAACATCC -3'
(R):5'- GACTGCCTCATGCTGCTG -3'
Posted On2020-02-27