Incidental Mutation 'R7639:Fam234b'
ID628302
Institutional Source Beutler Lab
Gene Symbol Fam234b
Ensembl Gene ENSMUSG00000030207
Gene Namefamily with sequence similarity 234, member B
Synonyms8430419L09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R7639 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location135197977-135244955 bp(+) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) A to T at 135225800 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000107547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111915] [ENSMUST00000111915] [ENSMUST00000111916] [ENSMUST00000111916]
Predicted Effect probably null
Transcript: ENSMUST00000111915
SMART Domains Protein: ENSMUSP00000107546
Gene: ENSMUSG00000030207

DomainStartEndE-ValueType
transmembrane domain 105 127 N/A INTRINSIC
low complexity region 500 517 N/A INTRINSIC
low complexity region 521 528 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000111915
SMART Domains Protein: ENSMUSP00000107546
Gene: ENSMUSG00000030207

DomainStartEndE-ValueType
transmembrane domain 105 127 N/A INTRINSIC
low complexity region 500 517 N/A INTRINSIC
low complexity region 521 528 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000111916
SMART Domains Protein: ENSMUSP00000107547
Gene: ENSMUSG00000030207

DomainStartEndE-ValueType
transmembrane domain 105 127 N/A INTRINSIC
low complexity region 500 517 N/A INTRINSIC
low complexity region 521 528 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000111916
SMART Domains Protein: ENSMUSP00000107547
Gene: ENSMUSG00000030207

DomainStartEndE-ValueType
transmembrane domain 105 127 N/A INTRINSIC
low complexity region 500 517 N/A INTRINSIC
low complexity region 521 528 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (45/46)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg5 T A 17: 84,670,103 M381L probably benign Het
Abl1 T A 2: 31,779,161 L184Q probably damaging Het
Atp8b1 A G 18: 64,564,543 V410A possibly damaging Het
Bhmt2 C T 13: 93,663,314 G205R probably damaging Het
Bicd1 A G 6: 149,513,004 D405G possibly damaging Het
Brip1 A T 11: 86,152,822 probably null Het
Ccdc180 A T 4: 45,928,043 I1193F possibly damaging Het
Cdc14b A G 13: 64,205,329 C478R possibly damaging Het
Celsr1 C T 15: 85,929,872 E1950K probably benign Het
Cnot7 A G 8: 40,507,453 probably null Het
Defa34 A T 8: 21,665,867 K24I probably benign Het
Dsg4 G T 18: 20,449,712 D136Y probably damaging Het
Dync2h1 C A 9: 7,141,254 V1258F probably damaging Het
Erbb3 A G 10: 128,569,847 S1181P probably damaging Het
Evl A G 12: 108,686,103 D366G probably damaging Het
Fanca A G 8: 123,291,395 probably null Het
Fbxo46 T A 7: 19,136,635 V393E probably damaging Het
Gkap1 T G 13: 58,263,970 K63T probably damaging Het
Hfm1 T A 5: 106,889,925 D742V probably benign Het
Hfm1 A G 5: 106,898,475 V515A possibly damaging Het
Itga10 G A 3: 96,649,582 V207I probably benign Het
Lipi T A 16: 75,560,855 Y274F probably benign Het
Mettl8 A T 2: 70,982,182 S36R probably benign Het
Miip A T 4: 147,862,564 M244K probably benign Het
Muc4 C G 16: 32,753,930 Q1269E probably benign Het
Nat10 G A 2: 103,743,090 A354V probably damaging Het
Nav1 T C 1: 135,471,122 N574S probably benign Het
Nlrc4 C T 17: 74,447,957 probably null Het
Oas2 C T 5: 120,745,686 W244* probably null Het
Oat A T 7: 132,566,801 I163N probably damaging Het
Olfr57 A G 10: 79,035,372 D192G probably damaging Het
Otop3 T C 11: 115,344,361 M273T possibly damaging Het
Poln A C 5: 34,133,151 V60G possibly damaging Het
Ppp1r13b G T 12: 111,833,615 A699E probably damaging Het
Rims1 A T 1: 22,805,669 M19K probably benign Het
Rnf145 T C 11: 44,531,357 L89P probably damaging Het
Rock1 A G 18: 10,140,244 S116P probably damaging Het
Rtn3 C T 19: 7,457,991 C212Y probably benign Het
Smcp G A 3: 92,584,490 P17S unknown Het
Syne2 A C 12: 75,934,499 E1525A probably damaging Het
Tpra1 A G 6: 88,910,176 D172G probably benign Het
Traf2 TAGA TA 2: 25,537,088 probably null Het
Trpa1 T C 1: 14,886,913 T760A probably benign Het
Unc13c T A 9: 73,933,168 S134C probably damaging Het
Zfp729b C T 13: 67,591,852 V765I probably benign Het
Other mutations in Fam234b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00536:Fam234b APN 6 135225204 missense probably damaging 1.00
IGL01020:Fam234b APN 6 135211906 missense probably benign 0.13
IGL01731:Fam234b APN 6 135211905 missense possibly damaging 0.90
IGL01994:Fam234b APN 6 135225205 nonsense probably null
IGL02010:Fam234b APN 6 135209407 missense probably benign 0.17
IGL02071:Fam234b APN 6 135227151 critical splice acceptor site probably null
IGL02340:Fam234b APN 6 135231661 missense probably damaging 1.00
IGL02869:Fam234b APN 6 135225203 missense probably damaging 1.00
R0076:Fam234b UTSW 6 135227226 missense probably benign 0.00
R0076:Fam234b UTSW 6 135227226 missense probably benign 0.00
R0123:Fam234b UTSW 6 135217074 missense possibly damaging 0.46
R0127:Fam234b UTSW 6 135218823 splice site probably benign
R0225:Fam234b UTSW 6 135217074 missense possibly damaging 0.46
R0570:Fam234b UTSW 6 135209249 missense probably benign 0.00
R0705:Fam234b UTSW 6 135227215 missense probably benign 0.11
R1140:Fam234b UTSW 6 135225758 missense probably benign 0.00
R1446:Fam234b UTSW 6 135209330 unclassified probably null
R1464:Fam234b UTSW 6 135228492 missense probably benign 0.00
R1464:Fam234b UTSW 6 135228492 missense probably benign 0.00
R2044:Fam234b UTSW 6 135226914 missense probably benign 0.04
R2350:Fam234b UTSW 6 135231724 missense probably damaging 1.00
R3914:Fam234b UTSW 6 135225683 missense probably damaging 1.00
R4261:Fam234b UTSW 6 135209136 missense unknown
R5102:Fam234b UTSW 6 135209284 missense probably benign 0.03
R5133:Fam234b UTSW 6 135209195 missense probably benign 0.01
R5313:Fam234b UTSW 6 135209187 missense possibly damaging 0.56
R5375:Fam234b UTSW 6 135233357 missense probably damaging 1.00
R5418:Fam234b UTSW 6 135226968 missense probably benign 0.00
R5838:Fam234b UTSW 6 135225267 missense probably benign 0.00
R5953:Fam234b UTSW 6 135225707 missense possibly damaging 0.95
R6737:Fam234b UTSW 6 135228515 missense probably damaging 0.99
R7056:Fam234b UTSW 6 135228452 missense probably benign 0.32
R7221:Fam234b UTSW 6 135228531 missense probably damaging 1.00
R7418:Fam234b UTSW 6 135217011 missense probably benign 0.04
R7459:Fam234b UTSW 6 135211901 missense probably benign 0.04
R7599:Fam234b UTSW 6 135226876 missense probably damaging 1.00
R7602:Fam234b UTSW 6 135225243 missense possibly damaging 0.79
R7748:Fam234b UTSW 6 135209351 missense probably damaging 1.00
R7773:Fam234b UTSW 6 135243914 missense probably benign 0.01
Z1177:Fam234b UTSW 6 135198008 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- ACCCAGCTGCTCAATTTGAC -3'
(R):5'- CCTTTAGTTGTTCTAATTCGGACTG -3'

Sequencing Primer
(F):5'- ACTCTTCCTGTGGCACTAGGAAAC -3'
(R):5'- AGTTGTTCTAATTCGGACTGTTAAG -3'
Posted On2020-02-27