Incidental Mutation 'R7715:Virma'
ID628313
Institutional Source Beutler Lab
Gene Symbol Virma
Ensembl Gene ENSMUSG00000040720
Gene Namevir like m6A methyltransferase associated
Synonyms1110037F02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7715 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location11485958-11550684 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 11513016 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000103943 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055372] [ENSMUST00000059914] [ENSMUST00000108307]
Predicted Effect probably null
Transcript: ENSMUST00000055372
SMART Domains Protein: ENSMUSP00000063188
Gene: ENSMUSG00000040720

DomainStartEndE-ValueType
low complexity region 139 153 N/A INTRINSIC
low complexity region 172 198 N/A INTRINSIC
low complexity region 236 267 N/A INTRINSIC
low complexity region 276 297 N/A INTRINSIC
low complexity region 615 625 N/A INTRINSIC
low complexity region 1008 1020 N/A INTRINSIC
low complexity region 1112 1124 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000059914
SMART Domains Protein: ENSMUSP00000058078
Gene: ENSMUSG00000040720

DomainStartEndE-ValueType
low complexity region 139 153 N/A INTRINSIC
low complexity region 172 198 N/A INTRINSIC
low complexity region 236 267 N/A INTRINSIC
low complexity region 276 297 N/A INTRINSIC
low complexity region 615 625 N/A INTRINSIC
low complexity region 1008 1020 N/A INTRINSIC
low complexity region 1112 1124 N/A INTRINSIC
low complexity region 1224 1232 N/A INTRINSIC
low complexity region 1443 1458 N/A INTRINSIC
low complexity region 1460 1474 N/A INTRINSIC
low complexity region 1618 1634 N/A INTRINSIC
low complexity region 1684 1697 N/A INTRINSIC
low complexity region 1750 1757 N/A INTRINSIC
low complexity region 1796 1808 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108307
SMART Domains Protein: ENSMUSP00000103943
Gene: ENSMUSG00000040720

DomainStartEndE-ValueType
Pfam:VIR_N 5 266 2e-110 PFAM
low complexity region 276 297 N/A INTRINSIC
low complexity region 615 625 N/A INTRINSIC
low complexity region 1058 1070 N/A INTRINSIC
low complexity region 1162 1174 N/A INTRINSIC
low complexity region 1274 1282 N/A INTRINSIC
low complexity region 1493 1508 N/A INTRINSIC
low complexity region 1510 1524 N/A INTRINSIC
low complexity region 1668 1684 N/A INTRINSIC
low complexity region 1734 1747 N/A INTRINSIC
low complexity region 1800 1807 N/A INTRINSIC
low complexity region 1846 1858 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (67/68)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik A G 1: 53,182,500 F57L probably benign Het
Agl C T 3: 116,758,256 R563Q Het
Ahctf1 A G 1: 179,770,848 M919T probably benign Het
Ano4 A T 10: 88,995,311 N483K probably damaging Het
Armt1 A G 10: 4,450,751 K166R probably benign Het
Asgr2 T C 11: 70,096,895 V73A probably benign Het
Atp6v0a2 A C 5: 124,714,198 T564P probably damaging Het
B3gntl1 T C 11: 121,639,796 T150A possibly damaging Het
Bach1 A G 16: 87,719,971 I467V possibly damaging Het
Bicd1 A G 6: 149,512,973 K395E probably benign Het
C330027C09Rik A T 16: 49,013,984 Q643L probably damaging Het
Cadps G A 14: 12,457,762 P1040S probably benign Het
Calcoco2 TCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC TCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC 11: 96,100,036 probably null Het
Canx A G 11: 50,310,804 S80P probably benign Het
Ccdc149 T A 5: 52,404,191 probably null Het
Cd34 A T 1: 194,949,316 N87Y probably damaging Het
Cdh11 T A 8: 102,664,714 I297F possibly damaging Het
Col14a1 A G 15: 55,487,983 I1569V unknown Het
Cxcr4 C T 1: 128,589,742 V61M probably damaging Het
Cyp20a1 G A 1: 60,372,605 V271M probably benign Het
Cyp2b23 T C 7: 26,681,695 Y79C probably benign Het
Daam1 A G 12: 71,988,901 K957E probably benign Het
Dip2c A G 13: 9,614,391 K947E probably damaging Het
Efcab12 T C 6: 115,823,543 K173R possibly damaging Het
Emc1 C T 4: 139,371,623 R806C probably damaging Het
Epg5 G A 18: 77,968,586 R816Q probably damaging Het
Faf1 G T 4: 109,710,814 D24Y probably damaging Het
Fchsd1 A T 18: 37,966,642 probably null Het
Foxp1 T C 6: 98,945,660 T404A unknown Het
Fra10ac1 T C 19: 38,189,838 E299G probably damaging Het
Gon4l A G 3: 88,908,006 T1959A probably benign Het
Gpam A C 19: 55,088,921 V146G probably benign Het
Hephl1 T A 9: 15,060,785 D953V probably benign Het
Kcnc2 G T 10: 112,271,940 E79* probably null Het
Kcnj12 T A 11: 61,066,952 probably null Het
Llgl2 A T 11: 115,849,728 T417S probably benign Het
Lrrc17 A T 5: 21,561,080 N187Y probably damaging Het
Macc1 C T 12: 119,446,256 A253V possibly damaging Het
Mark1 A G 1: 184,907,234 S529P probably damaging Het
Mfsd6l T C 11: 68,557,550 L409P probably damaging Het
Nek1 A G 8: 61,006,760 E34G probably damaging Het
Nlrp3 T A 11: 59,543,003 probably null Het
Obsl1 A T 1: 75,502,036 V686D probably damaging Het
Olfr1537 A T 9: 39,237,878 L182H probably damaging Het
Olfr167 C T 16: 19,514,730 R302K probably benign Het
Olfr545 T A 7: 102,494,461 M105L possibly damaging Het
Olfr871 G A 9: 20,212,435 G29R probably damaging Het
Olfr871 G A 9: 20,212,436 G29E probably benign Het
Olfr893 T A 9: 38,209,479 M140K probably benign Het
Ostm1 G A 10: 42,683,187 G148R probably benign Het
Oxsr1 A G 9: 119,242,756 S470P probably damaging Het
Pacs1 C T 19: 5,141,681 M709I probably benign Het
Pan2 A G 10: 128,317,723 M963V probably benign Het
Pds5a A G 5: 65,638,561 L662P possibly damaging Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,579,912 probably benign Het
Sh2b2 T C 5: 136,219,035 N554S probably benign Het
Sh3gl2 T A 4: 85,398,840 probably null Het
Slc24a4 A G 12: 102,218,960 M93V possibly damaging Het
Sohlh1 A G 2: 25,844,628 S218P possibly damaging Het
Spast T A 17: 74,368,926 N321K probably benign Het
Srcap T G 7: 127,549,288 I1936S probably damaging Het
Themis G A 10: 28,863,309 V592I probably benign Het
Tnfrsf1a C T 6: 125,361,414 T296I possibly damaging Het
Ttk A G 9: 83,865,153 T682A probably benign Het
Vmn2r101 T A 17: 19,611,915 D724E probably damaging Het
Vmn2r11 A G 5: 109,047,441 V673A probably damaging Het
Wbp4 C T 14: 79,466,294 S271N probably benign Het
Wdr66 A G 5: 123,262,134 N439D probably damaging Het
Other mutations in Virma
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Virma APN 4 11519424 splice site probably benign
IGL00477:Virma APN 4 11519006 missense probably damaging 0.99
IGL01293:Virma APN 4 11521114 missense probably damaging 1.00
IGL01410:Virma APN 4 11518929 nonsense probably null
IGL01531:Virma APN 4 11528753 missense probably damaging 1.00
IGL01672:Virma APN 4 11527792 missense probably damaging 1.00
IGL01724:Virma APN 4 11528672 missense probably damaging 1.00
IGL01747:Virma APN 4 11526877 missense probably damaging 1.00
IGL01776:Virma APN 4 11527792 missense probably damaging 1.00
IGL02064:Virma APN 4 11513163 missense possibly damaging 0.87
IGL02243:Virma APN 4 11546031 missense probably damaging 1.00
IGL02244:Virma APN 4 11546031 missense probably damaging 1.00
IGL02445:Virma APN 4 11527029 missense probably damaging 0.97
IGL02546:Virma APN 4 11494804 missense probably damaging 0.99
IGL02807:Virma APN 4 11507079 splice site probably benign
IGL02967:Virma APN 4 11514096 missense probably benign 0.01
IGL03211:Virma APN 4 11548770 nonsense probably null
IGL03242:Virma APN 4 11527669 missense possibly damaging 0.70
IGL03256:Virma APN 4 11542207 splice site probably benign
IGL03327:Virma APN 4 11518984 missense probably benign 0.00
IGL03346:Virma APN 4 11518984 missense probably benign 0.00
PIT4802001:Virma UTSW 4 11546008 missense probably damaging 0.99
R0142:Virma UTSW 4 11548783 missense probably benign 0.04
R0355:Virma UTSW 4 11528626 nonsense probably null
R0522:Virma UTSW 4 11519416 critical splice donor site probably null
R0600:Virma UTSW 4 11498769 missense probably damaging 0.99
R1435:Virma UTSW 4 11528621 missense probably damaging 1.00
R1489:Virma UTSW 4 11521164 missense probably damaging 1.00
R1568:Virma UTSW 4 11528776 missense probably damaging 0.99
R1616:Virma UTSW 4 11544954 missense probably damaging 1.00
R1655:Virma UTSW 4 11494786 missense probably damaging 1.00
R1695:Virma UTSW 4 11494814 missense probably damaging 0.98
R1835:Virma UTSW 4 11540511 missense probably benign 0.02
R1951:Virma UTSW 4 11513907 missense probably benign 0.00
R1991:Virma UTSW 4 11519242 missense probably benign 0.06
R2145:Virma UTSW 4 11548726 splice site probably benign
R2172:Virma UTSW 4 11527843 missense possibly damaging 0.82
R2217:Virma UTSW 4 11544924 missense probably damaging 1.00
R2218:Virma UTSW 4 11544924 missense probably damaging 1.00
R2248:Virma UTSW 4 11518927 missense probably damaging 1.00
R2342:Virma UTSW 4 11501316 missense probably damaging 1.00
R3424:Virma UTSW 4 11513177 nonsense probably null
R4397:Virma UTSW 4 11513901 missense possibly damaging 0.81
R4449:Virma UTSW 4 11498828 critical splice donor site probably null
R4660:Virma UTSW 4 11513505 missense probably damaging 1.00
R4698:Virma UTSW 4 11528636 missense probably damaging 0.99
R4878:Virma UTSW 4 11544971 missense probably damaging 1.00
R4937:Virma UTSW 4 11521147 nonsense probably null
R5031:Virma UTSW 4 11542116 nonsense probably null
R5040:Virma UTSW 4 11528746 missense probably benign 0.01
R5061:Virma UTSW 4 11494840 missense possibly damaging 0.95
R5091:Virma UTSW 4 11519392 missense probably benign 0.00
R5137:Virma UTSW 4 11546297 missense probably damaging 1.00
R5262:Virma UTSW 4 11539926 missense probably benign 0.01
R5297:Virma UTSW 4 11494819 missense probably damaging 1.00
R5730:Virma UTSW 4 11542154 missense probably benign 0.44
R5818:Virma UTSW 4 11513319 missense possibly damaging 0.92
R5835:Virma UTSW 4 11514036 missense probably damaging 1.00
R6125:Virma UTSW 4 11521172 missense probably damaging 0.98
R6197:Virma UTSW 4 11505498 missense probably damaging 0.96
R6222:Virma UTSW 4 11527820 missense probably damaging 1.00
R6793:Virma UTSW 4 11539968 missense probably damaging 1.00
R7028:Virma UTSW 4 11519249 missense possibly damaging 0.50
R7356:Virma UTSW 4 11513595 missense probably damaging 0.99
R7383:Virma UTSW 4 11514026 missense probably damaging 0.98
R7391:Virma UTSW 4 11508099 missense probably damaging 0.99
R7425:Virma UTSW 4 11546211 missense possibly damaging 0.95
R7556:Virma UTSW 4 11518927 missense probably damaging 1.00
R7715:Virma UTSW 4 11549682 missense probably damaging 1.00
R7986:Virma UTSW 4 11540023 missense probably benign 0.01
R7990:Virma UTSW 4 11513983 missense probably benign 0.00
R8048:Virma UTSW 4 11539918 nonsense probably null
R8050:Virma UTSW 4 11528643 missense probably benign 0.22
R8412:Virma UTSW 4 11521261 critical splice donor site probably null
R8544:Virma UTSW 4 11516949 missense probably benign
R8551:Virma UTSW 4 11513397 missense probably damaging 1.00
R8699:Virma UTSW 4 11528678 missense probably benign 0.04
R8739:Virma UTSW 4 11540643 critical splice donor site probably null
R8950:Virma UTSW 4 11519047 nonsense probably null
R9015:Virma UTSW 4 11540494 missense probably benign 0.27
X0020:Virma UTSW 4 11486055 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTGTCAGGAAAAGGTGTCATCAC -3'
(R):5'- ATACAAGAGTGGTGCCAGCTC -3'

Sequencing Primer
(F):5'- CATTCAAAGTTCAGATGCATG -3'
(R):5'- CCCTGTCATACGGGTCATACG -3'
Posted On2020-03-05