Incidental Mutation 'R7684:Tbkbp1'
ID628318
Institutional Source Beutler Lab
Gene Symbol Tbkbp1
Ensembl Gene ENSMUSG00000038517
Gene NameTBK1 binding protein 1
Synonyms3110043L15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7684 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location97136171-97151495 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 97147733 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000114460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066078] [ENSMUST00000107613] [ENSMUST00000107614] [ENSMUST00000107615] [ENSMUST00000118375] [ENSMUST00000146374]
Predicted Effect probably benign
Transcript: ENSMUST00000066078
SMART Domains Protein: ENSMUSP00000065461
Gene: ENSMUSG00000038517

DomainStartEndE-ValueType
low complexity region 24 35 N/A INTRINSIC
coiled coil region 47 156 N/A INTRINSIC
low complexity region 168 173 N/A INTRINSIC
low complexity region 178 194 N/A INTRINSIC
coiled coil region 218 278 N/A INTRINSIC
Pfam:TBD 287 342 2.8e-24 PFAM
low complexity region 343 432 N/A INTRINSIC
low complexity region 460 477 N/A INTRINSIC
low complexity region 552 562 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107613
SMART Domains Protein: ENSMUSP00000103238
Gene: ENSMUSG00000038517

DomainStartEndE-ValueType
low complexity region 24 35 N/A INTRINSIC
coiled coil region 47 152 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107614
SMART Domains Protein: ENSMUSP00000103239
Gene: ENSMUSG00000038517

DomainStartEndE-ValueType
low complexity region 24 35 N/A INTRINSIC
coiled coil region 47 156 N/A INTRINSIC
low complexity region 168 173 N/A INTRINSIC
low complexity region 178 194 N/A INTRINSIC
coiled coil region 218 278 N/A INTRINSIC
Pfam:TBD 289 343 4.1e-21 PFAM
low complexity region 460 477 N/A INTRINSIC
low complexity region 552 562 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107615
SMART Domains Protein: ENSMUSP00000103240
Gene: ENSMUSG00000038517

DomainStartEndE-ValueType
low complexity region 24 35 N/A INTRINSIC
coiled coil region 47 156 N/A INTRINSIC
low complexity region 168 173 N/A INTRINSIC
low complexity region 178 194 N/A INTRINSIC
coiled coil region 217 277 N/A INTRINSIC
Pfam:TBD 286 341 4e-25 PFAM
low complexity region 342 431 N/A INTRINSIC
low complexity region 459 476 N/A INTRINSIC
low complexity region 551 561 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118375
SMART Domains Protein: ENSMUSP00000112396
Gene: ENSMUSG00000038517

DomainStartEndE-ValueType
low complexity region 24 35 N/A INTRINSIC
coiled coil region 47 156 N/A INTRINSIC
low complexity region 168 173 N/A INTRINSIC
low complexity region 178 194 N/A INTRINSIC
coiled coil region 217 277 N/A INTRINSIC
Pfam:TBD 286 341 4e-25 PFAM
low complexity region 342 431 N/A INTRINSIC
low complexity region 459 476 N/A INTRINSIC
low complexity region 551 561 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146374
SMART Domains Protein: ENSMUSP00000114460
Gene: ENSMUSG00000038517

DomainStartEndE-ValueType
low complexity region 24 35 N/A INTRINSIC
coiled coil region 47 145 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TBKBP1 is an adaptor protein that binds to TBK1 (MIM 604834) and is part of the interaction network in the TNF (MIM 191160)/NFKB (see MIM 164011) pathway (Bouwmeester et al., 2004 [PubMed 14743216]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal GM-CSF-derived bone marrow-derived dendritic cell differentiation and physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,612,540 K1239* probably null Het
Abhd6 T C 14: 8,039,807 F60S probably damaging Het
Adam6b G A 12: 113,491,576 W671* probably null Het
Ankrd36 A G 11: 5,570,113 T63A possibly damaging Het
Arhgef16 A G 4: 154,281,828 V494A possibly damaging Het
Arhgef7 T A 8: 11,819,663 M659K probably benign Het
Cacna1h A G 17: 25,389,372 Y854H probably damaging Het
Chd3 A T 11: 69,357,866 F780I possibly damaging Het
Cldn8 A G 16: 88,562,447 Y197H probably damaging Het
Cpne8 A T 15: 90,649,247 D58E probably damaging Het
Cul9 T G 17: 46,509,889 Y1954S probably damaging Het
Cyp4a10 T A 4: 115,518,352 F11I probably benign Het
Cysrt1 A T 2: 25,239,082 C139* probably null Het
Dnajc16 A G 4: 141,774,568 V317A probably benign Het
Dnmt3a T C 12: 3,897,340 V437A probably benign Het
Dok5 T C 2: 170,841,424 C202R probably damaging Het
Dusp11 T A 6: 85,950,560 R164S probably damaging Het
Dysf T C 6: 84,100,135 S648P probably benign Het
Egfem1 A T 3: 29,690,185 R581S probably damaging Het
Enpep A G 3: 129,321,445 F226S probably damaging Het
Ep400 A G 5: 110,697,352 I1541T unknown Het
Exd1 A G 2: 119,520,203 S526P probably damaging Het
Fam118a A G 15: 85,058,781 E337G possibly damaging Het
Fam20b T C 1: 156,690,645 N193S probably benign Het
Fat3 A G 9: 15,988,268 probably null Het
Flg2 T C 3: 93,219,649 V1956A unknown Het
Fzd10 A G 5: 128,601,416 I67V possibly damaging Het
Gckr A T 5: 31,307,797 D370V probably damaging Het
Gm8797 A T 3: 5,751,088 Q62L probably benign Het
H6pd G T 4: 149,996,062 Q109K probably benign Het
Higd1a T C 9: 121,850,256 K55R possibly damaging Het
Il1b C T 2: 129,367,357 V118I probably benign Het
Insr T C 8: 3,169,753 N923S possibly damaging Het
Krit1 A G 5: 3,830,723 I561V possibly damaging Het
Lamc2 T C 1: 153,127,025 D1070G probably null Het
Lpcat2 T A 8: 92,909,195 D408E possibly damaging Het
Mst1r T A 9: 107,911,563 F427Y probably benign Het
Mtx1 A T 3: 89,210,432 I258K possibly damaging Het
Nckap5 T C 1: 126,026,857 T653A probably benign Het
Npas3 A T 12: 54,068,826 N844Y probably damaging Het
Nrg3 A T 14: 39,472,565 L79Q probably damaging Het
Nsmce1 C A 7: 125,471,176 K154N probably damaging Het
Oard1 T C 17: 48,416,698 L124P probably damaging Het
Olfr1122 T C 2: 87,388,028 S108P probably damaging Het
Olfr1337 T C 4: 118,782,274 M104V probably benign Het
Olfr615 T C 7: 103,561,218 F247S probably benign Het
Olfr642 G A 7: 104,049,460 T298I probably damaging Het
Ovgp1 A T 3: 105,979,956 T223S probably damaging Het
Pik3c2a A T 7: 116,388,077 Y536* probably null Het
Plekho2 A T 9: 65,559,534 probably null Het
Prelid3b T C 2: 174,468,417 probably null Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rxfp1 T A 3: 79,670,907 N159I possibly damaging Het
Sfmbt1 A G 14: 30,810,354 Q557R probably damaging Het
Slc22a18 G T 7: 143,490,840 V177L probably benign Het
Slc22a8 A G 19: 8,609,930 I451M probably benign Het
Slc39a12 T C 2: 14,449,859 S563P probably damaging Het
Snx20 T C 8: 88,627,235 D289G probably benign Het
Sptb A G 12: 76,612,195 Y1189H probably benign Het
Tbc1d1 T A 5: 64,316,486 M784K probably benign Het
Tfap2b G C 1: 19,214,287 D140H probably damaging Het
Thy1 G A 9: 44,046,558 G13D unknown Het
Ticam1 A G 17: 56,269,984 S704P unknown Het
Tmem151b A G 17: 45,547,003 Y106H probably damaging Het
Trappc8 T C 18: 20,863,502 N452S probably benign Het
Ttc9c A G 19: 8,811,764 Y166H probably damaging Het
Txndc16 A G 14: 45,147,868 V556A possibly damaging Het
Tyrp1 C A 4: 80,840,625 S245Y probably damaging Het
Urb1 A T 16: 90,786,118 L621* probably null Het
Wdr72 A T 9: 74,147,010 T224S probably damaging Het
Zc3h18 T G 8: 122,407,426 S544A unknown Het
Zfp462 T A 4: 55,008,908 N291K probably benign Het
Zfp609 T C 9: 65,731,080 N290S possibly damaging Het
Zfp979 A T 4: 147,613,342 H303Q probably damaging Het
Other mutations in Tbkbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Tbkbp1 APN 11 97137648 unclassified probably benign
IGL01071:Tbkbp1 APN 11 97149562 missense probably damaging 0.99
R0017:Tbkbp1 UTSW 11 97146289 unclassified probably benign
R0445:Tbkbp1 UTSW 11 97149469 missense probably damaging 1.00
R1468:Tbkbp1 UTSW 11 97148988 missense probably damaging 1.00
R1468:Tbkbp1 UTSW 11 97148988 missense probably damaging 1.00
R4198:Tbkbp1 UTSW 11 97149068 critical splice acceptor site probably null
R4737:Tbkbp1 UTSW 11 97148648 missense probably damaging 1.00
R4816:Tbkbp1 UTSW 11 97138741 missense probably benign 0.23
R4910:Tbkbp1 UTSW 11 97139130 missense probably benign 0.23
R4947:Tbkbp1 UTSW 11 97138944 utr 3 prime probably benign
R5571:Tbkbp1 UTSW 11 97148729 missense probably damaging 1.00
R6083:Tbkbp1 UTSW 11 97147380 missense probably damaging 1.00
R6207:Tbkbp1 UTSW 11 97146339 missense probably damaging 1.00
R6595:Tbkbp1 UTSW 11 97138752 utr 3 prime probably benign
R7678:Tbkbp1 UTSW 11 97149483 missense probably damaging 1.00
R8425:Tbkbp1 UTSW 11 97138851 missense unknown
R8495:Tbkbp1 UTSW 11 97146603 missense probably benign 0.04
X0020:Tbkbp1 UTSW 11 97148974 missense probably damaging 0.99
Z1176:Tbkbp1 UTSW 11 97149528 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- TGCCGTAGATGAGTCTCTACC -3'
(R):5'- AACGTTTGCTTGGTAGTCGC -3'

Sequencing Primer
(F):5'- TAGATGAGTCTCTACCAGGGC -3'
(R):5'- GCTATCCCCATTTTATACAGGAGG -3'
Posted On2020-03-05