Incidental Mutation 'R7640:Atr'
ID 628328
Institutional Source Beutler Lab
Gene Symbol Atr
Ensembl Gene ENSMUSG00000032409
Gene Name ataxia telangiectasia and Rad3 related
Synonyms
MMRRC Submission 045698-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7640 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 95739650-95833834 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to G at 95789346 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000149953 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034980] [ENSMUST00000215311]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000034980
SMART Domains Protein: ENSMUSP00000034980
Gene: ENSMUSG00000032409

DomainStartEndE-ValueType
low complexity region 431 449 N/A INTRINSIC
low complexity region 889 897 N/A INTRINSIC
low complexity region 998 1013 N/A INTRINSIC
UME 1119 1225 2.3e-43 SMART
low complexity region 1352 1362 N/A INTRINSIC
Pfam:FAT 1771 2092 9.2e-51 PFAM
PI3Kc 2320 2630 7.51e-124 SMART
FATC 2609 2641 6.22e-13 SMART
Predicted Effect probably null
Transcript: ENSMUST00000215311
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs the PI3/PI4-kinase family, and is most closely related to ATM, a protein kinase encoded by the gene mutated in ataxia telangiectasia. This protein and ATM share similarity with Schizosaccharomyces pombe rad3, a cell cycle checkpoint gene required for cell cycle arrest and DNA damage repair in response to DNA damage. This kinase has been shown to phosphorylate checkpoint kinase CHK1, checkpoint proteins RAD17, and RAD9, as well as tumor suppressor protein BRCA1. Mutations of this gene are associated with Seckel syndrome. An alternatively spliced transcript variant of this gene has been reported, however, its full length nature is not known. Transcript variants utilizing alternative polyA sites exist. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early embryonic lethality. Mice heterozygous for a knock-out allele exhibit premature death and increased tumor incidence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik A T 4: 137,181,905 (GRCm39) N20I probably damaging Het
4930558K02Rik A G 1: 161,784,718 (GRCm39) S74P probably benign Het
Abcb6 A T 1: 75,151,489 (GRCm39) probably null Het
Adamts14 C A 10: 61,081,836 (GRCm39) A234S probably benign Het
Ankrd42 A G 7: 92,268,843 (GRCm39) S167P probably benign Het
Ap3m1 T C 14: 21,088,243 (GRCm39) I272V probably benign Het
Armt1 T C 10: 4,403,572 (GRCm39) F219S probably damaging Het
Cep72 G A 13: 74,206,607 (GRCm39) Q72* probably null Het
Clock G T 5: 76,396,225 (GRCm39) L175M possibly damaging Het
Cnmd T A 14: 79,898,974 (GRCm39) Y26F possibly damaging Het
Col6a6 A T 9: 105,662,943 (GRCm39) M198K possibly damaging Het
Cuta C T 17: 27,157,396 (GRCm39) V135I probably benign Het
Ddx41 A T 13: 55,682,052 (GRCm39) M241K possibly damaging Het
Dnajc22 A G 15: 98,998,995 (GRCm39) N60S probably damaging Het
Drc3 A G 11: 60,279,730 (GRCm39) M432V probably benign Het
Dync2i2 T G 2: 29,921,780 (GRCm39) D527A probably benign Het
Eef1d C A 15: 75,774,556 (GRCm39) G368C probably damaging Het
En2 A T 5: 28,375,164 (GRCm39) K236* probably null Het
Fas A G 19: 34,284,564 (GRCm39) T24A possibly damaging Het
Golga2 T C 2: 32,196,251 (GRCm39) V930A probably benign Het
Gprin2 G T 14: 33,917,710 (GRCm39) A20D probably benign Het
Ighv14-4 A T 12: 114,140,064 (GRCm39) C115* probably null Het
Impdh2 T C 9: 108,442,380 (GRCm39) Y459H possibly damaging Het
Klhdc7b G T 15: 89,271,463 (GRCm39) V124L possibly damaging Het
L2hgdh A T 12: 69,768,131 (GRCm39) Y122* probably null Het
Lamc2 A T 1: 153,012,550 (GRCm39) I708N possibly damaging Het
Large2 T C 2: 92,205,050 (GRCm39) M1V probably null Het
Lrit2 T C 14: 36,794,081 (GRCm39) W382R probably damaging Het
Mcee T A 7: 64,061,716 (GRCm39) V173E probably damaging Het
Mcph1 T A 8: 18,682,342 (GRCm39) V493E probably benign Het
Mfap4 A G 11: 61,377,913 (GRCm39) N118D probably damaging Het
Mknk2 T C 10: 80,504,400 (GRCm39) S301G probably benign Het
Mlf1 G A 3: 67,300,266 (GRCm39) M94I possibly damaging Het
Mrc2 T A 11: 105,223,121 (GRCm39) S455T possibly damaging Het
Mrgprb5 T G 7: 47,818,007 (GRCm39) I243L probably benign Het
Muc4 C A 16: 32,580,479 (GRCm39) P360T Het
Nat10 G A 2: 103,573,435 (GRCm39) A354V probably damaging Het
Nscme3l T A 19: 5,553,035 (GRCm39) S249C probably damaging Het
Nts T C 10: 102,326,165 (GRCm39) Q7R possibly damaging Het
Oas1b T C 5: 120,959,479 (GRCm39) L288P probably damaging Het
Or4a66 T A 2: 88,531,230 (GRCm39) I148L probably benign Het
Or51k2 A T 7: 103,596,150 (GRCm39) I126F probably damaging Het
Or5w11 A G 2: 87,459,436 (GRCm39) I94V probably benign Het
Or8k30 A G 2: 86,339,287 (GRCm39) I161M possibly damaging Het
Otoa A G 7: 120,744,849 (GRCm39) E869G probably damaging Het
Pcdhac2 T C 18: 37,277,578 (GRCm39) L186P probably damaging Het
Plekhh2 A G 17: 84,918,204 (GRCm39) E1271G possibly damaging Het
Pmepa1 C T 2: 173,117,956 (GRCm39) A8T probably benign Het
Pramel24 T C 4: 143,453,276 (GRCm39) V128A probably benign Het
Rc3h2 A G 2: 37,267,861 (GRCm39) probably null Het
Rlf T A 4: 121,003,998 (GRCm39) M1771L possibly damaging Het
Rpap1 G A 2: 119,594,891 (GRCm39) P1372L possibly damaging Het
Rragd A T 4: 32,983,527 (GRCm39) D22V probably benign Het
Sema3f A T 9: 107,560,774 (GRCm39) S644R probably benign Het
Sp110 G A 1: 85,506,813 (GRCm39) R417C probably benign Het
Spata31h1 T A 10: 82,130,490 (GRCm39) N840I probably damaging Het
Specc1l T A 10: 75,093,703 (GRCm39) N717K probably damaging Het
Sphkap C T 1: 83,256,649 (GRCm39) D367N possibly damaging Het
Tbc1d21 C T 9: 58,268,544 (GRCm39) V272M probably damaging Het
Tlcd4 A G 3: 121,028,690 (GRCm39) probably null Het
Tmem132c A G 5: 127,640,070 (GRCm39) D747G probably damaging Het
Trim2 C A 3: 84,098,213 (GRCm39) V372F probably benign Het
Ttc34 A G 4: 154,945,841 (GRCm39) T292A probably benign Het
Ube3b A G 5: 114,553,384 (GRCm39) T919A probably benign Het
Zfhx4 T C 3: 5,477,540 (GRCm39) I3385T probably benign Het
Zfp423 T C 8: 88,507,905 (GRCm39) K813R probably damaging Het
Zfp850 T C 7: 27,688,634 (GRCm39) T525A probably benign Het
Zfp873 T C 10: 81,896,109 (GRCm39) I280T possibly damaging Het
Zkscan7 A G 9: 122,725,121 (GRCm39) T697A possibly damaging Het
Other mutations in Atr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00640:Atr APN 9 95,747,105 (GRCm39) missense probably damaging 1.00
IGL00922:Atr APN 9 95,789,398 (GRCm39) missense probably damaging 0.97
IGL01020:Atr APN 9 95,744,836 (GRCm39) missense probably damaging 1.00
IGL01345:Atr APN 9 95,823,002 (GRCm39) missense probably damaging 1.00
IGL01364:Atr APN 9 95,747,677 (GRCm39) missense probably benign 0.29
IGL01456:Atr APN 9 95,832,618 (GRCm39) missense possibly damaging 0.62
IGL01534:Atr APN 9 95,747,599 (GRCm39) missense probably damaging 0.99
IGL01761:Atr APN 9 95,833,501 (GRCm39) splice site probably benign
IGL01791:Atr APN 9 95,803,834 (GRCm39) missense probably benign 0.05
IGL01831:Atr APN 9 95,752,807 (GRCm39) missense probably benign 0.18
IGL01973:Atr APN 9 95,753,727 (GRCm39) missense probably damaging 1.00
IGL02008:Atr APN 9 95,763,473 (GRCm39) splice site probably benign
IGL02016:Atr APN 9 95,809,228 (GRCm39) missense probably benign 0.09
IGL02035:Atr APN 9 95,748,735 (GRCm39) missense probably benign 0.01
IGL02058:Atr APN 9 95,753,540 (GRCm39) missense probably damaging 0.99
IGL02081:Atr APN 9 95,765,258 (GRCm39) missense probably damaging 1.00
IGL02224:Atr APN 9 95,760,682 (GRCm39) missense probably damaging 0.98
IGL02234:Atr APN 9 95,829,303 (GRCm39) splice site probably benign
IGL02367:Atr APN 9 95,781,194 (GRCm39) nonsense probably null
IGL02621:Atr APN 9 95,790,453 (GRCm39) missense probably benign 0.00
IGL02728:Atr APN 9 95,818,528 (GRCm39) missense probably damaging 1.00
IGL02833:Atr APN 9 95,744,905 (GRCm39) missense probably damaging 1.00
IGL02939:Atr APN 9 95,747,314 (GRCm39) missense probably benign
IGL03107:Atr APN 9 95,779,783 (GRCm39) missense probably benign 0.28
IGL03382:Atr APN 9 95,802,875 (GRCm39) nonsense probably null
PIT4812001:Atr UTSW 9 95,792,702 (GRCm39) missense probably benign 0.41
R0042:Atr UTSW 9 95,809,409 (GRCm39) splice site probably benign
R0042:Atr UTSW 9 95,809,409 (GRCm39) splice site probably benign
R0281:Atr UTSW 9 95,819,619 (GRCm39) missense probably benign 0.26
R0282:Atr UTSW 9 95,744,851 (GRCm39) missense probably benign 0.12
R0512:Atr UTSW 9 95,817,579 (GRCm39) missense probably damaging 0.99
R0547:Atr UTSW 9 95,781,218 (GRCm39) splice site probably benign
R0567:Atr UTSW 9 95,747,882 (GRCm39) missense probably benign 0.00
R0631:Atr UTSW 9 95,756,830 (GRCm39) missense possibly damaging 0.92
R1116:Atr UTSW 9 95,749,689 (GRCm39) nonsense probably null
R1171:Atr UTSW 9 95,789,376 (GRCm39) missense probably damaging 1.00
R1241:Atr UTSW 9 95,832,689 (GRCm39) missense probably benign 0.08
R1345:Atr UTSW 9 95,802,408 (GRCm39) missense probably benign 0.25
R1400:Atr UTSW 9 95,744,901 (GRCm39) missense probably benign 0.32
R1413:Atr UTSW 9 95,814,495 (GRCm39) missense probably damaging 1.00
R1527:Atr UTSW 9 95,752,096 (GRCm39) missense possibly damaging 0.82
R1557:Atr UTSW 9 95,753,502 (GRCm39) missense probably damaging 1.00
R1591:Atr UTSW 9 95,827,438 (GRCm39) missense probably damaging 1.00
R1602:Atr UTSW 9 95,833,610 (GRCm39) missense probably damaging 1.00
R1605:Atr UTSW 9 95,818,516 (GRCm39) missense probably damaging 1.00
R1670:Atr UTSW 9 95,743,509 (GRCm39) missense probably benign 0.38
R1709:Atr UTSW 9 95,753,129 (GRCm39) missense probably benign 0.00
R1728:Atr UTSW 9 95,779,634 (GRCm39) missense probably benign 0.01
R1729:Atr UTSW 9 95,779,634 (GRCm39) missense probably benign 0.01
R1739:Atr UTSW 9 95,779,634 (GRCm39) missense probably benign 0.01
R1816:Atr UTSW 9 95,748,747 (GRCm39) missense probably benign 0.00
R1824:Atr UTSW 9 95,818,474 (GRCm39) missense probably damaging 1.00
R1844:Atr UTSW 9 95,787,870 (GRCm39) missense probably benign 0.01
R1857:Atr UTSW 9 95,747,150 (GRCm39) missense probably damaging 1.00
R1858:Atr UTSW 9 95,747,150 (GRCm39) missense probably damaging 1.00
R1866:Atr UTSW 9 95,752,658 (GRCm39) splice site probably null
R1913:Atr UTSW 9 95,748,786 (GRCm39) missense probably benign 0.01
R2042:Atr UTSW 9 95,752,075 (GRCm39) missense probably benign 0.00
R2210:Atr UTSW 9 95,789,353 (GRCm39) missense probably damaging 1.00
R2230:Atr UTSW 9 95,802,818 (GRCm39) missense probably damaging 1.00
R2361:Atr UTSW 9 95,753,210 (GRCm39) missense probably benign 0.41
R2399:Atr UTSW 9 95,753,652 (GRCm39) missense probably benign 0.00
R2431:Atr UTSW 9 95,744,945 (GRCm39) missense probably benign 0.24
R2860:Atr UTSW 9 95,756,296 (GRCm39) missense probably benign 0.07
R2861:Atr UTSW 9 95,756,296 (GRCm39) missense probably benign 0.07
R3019:Atr UTSW 9 95,787,871 (GRCm39) missense possibly damaging 0.52
R3684:Atr UTSW 9 95,802,453 (GRCm39) missense probably damaging 0.96
R4155:Atr UTSW 9 95,770,177 (GRCm39) nonsense probably null
R4295:Atr UTSW 9 95,756,479 (GRCm39) missense probably benign 0.04
R4359:Atr UTSW 9 95,833,589 (GRCm39) missense probably damaging 1.00
R4506:Atr UTSW 9 95,747,290 (GRCm39) missense probably benign 0.21
R4523:Atr UTSW 9 95,744,916 (GRCm39) missense probably damaging 1.00
R4536:Atr UTSW 9 95,756,471 (GRCm39) missense probably benign 0.26
R4588:Atr UTSW 9 95,747,720 (GRCm39) missense probably benign
R4646:Atr UTSW 9 95,753,250 (GRCm39) critical splice donor site probably null
R4702:Atr UTSW 9 95,802,408 (GRCm39) missense possibly damaging 0.92
R4743:Atr UTSW 9 95,744,845 (GRCm39) missense probably benign 0.14
R4782:Atr UTSW 9 95,744,850 (GRCm39) missense probably benign 0.00
R4928:Atr UTSW 9 95,789,352 (GRCm39) missense probably damaging 1.00
R5031:Atr UTSW 9 95,747,755 (GRCm39) missense probably damaging 0.98
R5138:Atr UTSW 9 95,819,649 (GRCm39) missense probably benign 0.15
R5188:Atr UTSW 9 95,803,778 (GRCm39) missense probably benign 0.00
R5219:Atr UTSW 9 95,763,291 (GRCm39) missense probably damaging 0.99
R5307:Atr UTSW 9 95,760,597 (GRCm39) missense probably benign 0.01
R5414:Atr UTSW 9 95,752,757 (GRCm39) missense probably benign 0.00
R5628:Atr UTSW 9 95,756,279 (GRCm39) nonsense probably null
R5664:Atr UTSW 9 95,787,866 (GRCm39) missense probably benign 0.00
R5678:Atr UTSW 9 95,833,540 (GRCm39) nonsense probably null
R5724:Atr UTSW 9 95,748,641 (GRCm39) missense probably damaging 1.00
R5759:Atr UTSW 9 95,756,455 (GRCm39) missense probably benign 0.01
R5763:Atr UTSW 9 95,827,176 (GRCm39) missense probably benign 0.04
R5922:Atr UTSW 9 95,785,735 (GRCm39) missense probably benign 0.00
R6051:Atr UTSW 9 95,790,422 (GRCm39) missense possibly damaging 0.85
R6161:Atr UTSW 9 95,747,372 (GRCm39) missense probably benign
R6171:Atr UTSW 9 95,763,324 (GRCm39) nonsense probably null
R6532:Atr UTSW 9 95,790,461 (GRCm39) missense probably benign
R6774:Atr UTSW 9 95,809,266 (GRCm39) missense probably benign 0.00
R6894:Atr UTSW 9 95,809,250 (GRCm39) missense probably damaging 1.00
R6930:Atr UTSW 9 95,748,688 (GRCm39) missense probably benign 0.21
R7018:Atr UTSW 9 95,748,747 (GRCm39) missense probably benign 0.17
R7056:Atr UTSW 9 95,744,916 (GRCm39) missense probably damaging 1.00
R7103:Atr UTSW 9 95,747,425 (GRCm39) missense probably damaging 0.98
R7154:Atr UTSW 9 95,747,098 (GRCm39) missense probably benign
R7157:Atr UTSW 9 95,751,953 (GRCm39) missense probably benign 0.00
R7188:Atr UTSW 9 95,744,844 (GRCm39) nonsense probably null
R7189:Atr UTSW 9 95,744,844 (GRCm39) nonsense probably null
R7300:Atr UTSW 9 95,747,423 (GRCm39) missense probably benign 0.00
R7337:Atr UTSW 9 95,753,501 (GRCm39) missense probably damaging 1.00
R7584:Atr UTSW 9 95,824,766 (GRCm39) missense probably damaging 1.00
R7602:Atr UTSW 9 95,789,436 (GRCm39) missense possibly damaging 0.64
R7633:Atr UTSW 9 95,829,171 (GRCm39) missense probably damaging 1.00
R7677:Atr UTSW 9 95,767,515 (GRCm39) missense probably damaging 1.00
R7699:Atr UTSW 9 95,757,743 (GRCm39) nonsense probably null
R7700:Atr UTSW 9 95,757,743 (GRCm39) nonsense probably null
R7790:Atr UTSW 9 95,756,233 (GRCm39) missense probably damaging 1.00
R8027:Atr UTSW 9 95,747,809 (GRCm39) missense probably damaging 0.99
R8147:Atr UTSW 9 95,781,113 (GRCm39) missense probably damaging 1.00
R8204:Atr UTSW 9 95,817,566 (GRCm39) missense
R8306:Atr UTSW 9 95,802,423 (GRCm39) missense
R8462:Atr UTSW 9 95,749,579 (GRCm39) missense probably benign
R8716:Atr UTSW 9 95,789,468 (GRCm39) missense probably benign 0.09
R8748:Atr UTSW 9 95,814,476 (GRCm39) missense probably benign 0.00
R8795:Atr UTSW 9 95,749,584 (GRCm39) missense probably damaging 1.00
R8891:Atr UTSW 9 95,787,813 (GRCm39) missense probably benign 0.03
R8976:Atr UTSW 9 95,772,819 (GRCm39) missense probably benign 0.00
R9024:Atr UTSW 9 95,789,416 (GRCm39) missense possibly damaging 0.93
R9116:Atr UTSW 9 95,747,851 (GRCm39) missense probably benign 0.00
R9523:Atr UTSW 9 95,792,610 (GRCm39) missense possibly damaging 0.89
R9524:Atr UTSW 9 95,792,610 (GRCm39) missense possibly damaging 0.89
R9525:Atr UTSW 9 95,792,610 (GRCm39) missense possibly damaging 0.89
R9527:Atr UTSW 9 95,767,429 (GRCm39) missense probably damaging 1.00
R9563:Atr UTSW 9 95,802,833 (GRCm39) missense probably damaging 0.98
R9629:Atr UTSW 9 95,747,098 (GRCm39) missense probably benign
R9642:Atr UTSW 9 95,821,294 (GRCm39) missense probably damaging 1.00
R9652:Atr UTSW 9 95,756,887 (GRCm39) missense probably damaging 1.00
R9660:Atr UTSW 9 95,797,050 (GRCm39) missense probably benign 0.40
R9678:Atr UTSW 9 95,792,610 (GRCm39) missense possibly damaging 0.89
R9728:Atr UTSW 9 95,797,050 (GRCm39) missense probably benign 0.40
R9731:Atr UTSW 9 95,747,092 (GRCm39) missense possibly damaging 0.52
R9732:Atr UTSW 9 95,743,438 (GRCm39) missense probably damaging 1.00
R9749:Atr UTSW 9 95,819,703 (GRCm39) critical splice donor site probably null
X0019:Atr UTSW 9 95,822,924 (GRCm39) missense probably damaging 1.00
Z1088:Atr UTSW 9 95,767,373 (GRCm39) splice site probably null
Z1177:Atr UTSW 9 95,770,153 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTAGCAGCTACATTCCCACTAG -3'
(R):5'- GTTCAGAACTCAAGTCACATGTC -3'

Sequencing Primer
(F):5'- ACTAGGATCTCAGTACTTTTGGC -3'
(R):5'- TCAAGTCACATGTCTGGAAACC -3'
Posted On 2020-03-06