Incidental Mutation 'R7640:Atr'
ID 628328
Institutional Source Beutler Lab
Gene Symbol Atr
Ensembl Gene ENSMUSG00000032409
Gene Name ataxia telangiectasia and Rad3 related
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7640 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 95857597-95951781 bp(+) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) T to G at 95907293 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000149953 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034980] [ENSMUST00000215311]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000034980
SMART Domains Protein: ENSMUSP00000034980
Gene: ENSMUSG00000032409

DomainStartEndE-ValueType
low complexity region 431 449 N/A INTRINSIC
low complexity region 889 897 N/A INTRINSIC
low complexity region 998 1013 N/A INTRINSIC
UME 1119 1225 2.3e-43 SMART
low complexity region 1352 1362 N/A INTRINSIC
Pfam:FAT 1771 2092 9.2e-51 PFAM
PI3Kc 2320 2630 7.51e-124 SMART
FATC 2609 2641 6.22e-13 SMART
Predicted Effect probably null
Transcript: ENSMUST00000215311
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs the PI3/PI4-kinase family, and is most closely related to ATM, a protein kinase encoded by the gene mutated in ataxia telangiectasia. This protein and ATM share similarity with Schizosaccharomyces pombe rad3, a cell cycle checkpoint gene required for cell cycle arrest and DNA damage repair in response to DNA damage. This kinase has been shown to phosphorylate checkpoint kinase CHK1, checkpoint proteins RAD17, and RAD9, as well as tumor suppressor protein BRCA1. Mutations of this gene are associated with Seckel syndrome. An alternatively spliced transcript variant of this gene has been reported, however, its full length nature is not known. Transcript variants utilizing alternative polyA sites exist. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early embryonic lethality. Mice heterozygous for a knock-out allele exhibit premature death and increased tumor incidence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik A T 4: 137,454,594 N20I probably damaging Het
1700020D05Rik T A 19: 5,503,007 S249C probably damaging Het
4930558K02Rik A G 1: 161,957,149 S74P probably benign Het
4932415D10Rik T A 10: 82,294,656 N840I probably damaging Het
Abcb6 A T 1: 75,174,845 probably null Het
Adamts14 C A 10: 61,246,057 A234S probably benign Het
Ankrd42 A G 7: 92,619,635 S167P probably benign Het
Ap3m1 T C 14: 21,038,175 I272V probably benign Het
Armt1 T C 10: 4,453,572 F219S probably damaging Het
Cep72 G A 13: 74,058,488 Q72* probably null Het
Clock G T 5: 76,248,378 L175M possibly damaging Het
Cnmd T A 14: 79,661,534 Y26F possibly damaging Het
Col6a6 A T 9: 105,785,744 M198K possibly damaging Het
Cuta C T 17: 26,938,422 V135I probably benign Het
Ddx41 A T 13: 55,534,239 M241K possibly damaging Het
Dnajc22 A G 15: 99,101,114 N60S probably damaging Het
Drc3 A G 11: 60,388,904 M432V probably benign Het
Eef1d C A 15: 75,902,707 G368C probably damaging Het
En2 A T 5: 28,170,166 K236* probably null Het
Fas A G 19: 34,307,164 T24A possibly damaging Het
Gm13078 T C 4: 143,726,706 V128A probably benign Het
Golga2 T C 2: 32,306,239 V930A probably benign Het
Gprin2 G T 14: 34,195,753 A20D probably benign Het
Ighv14-4 A T 12: 114,176,444 C115* probably null Het
Impdh2 T C 9: 108,565,181 Y459H possibly damaging Het
Klhdc7b G T 15: 89,387,260 V124L possibly damaging Het
L2hgdh A T 12: 69,721,357 Y122* probably null Het
Lamc2 A T 1: 153,136,804 I708N possibly damaging Het
Large2 T C 2: 92,374,705 M1V probably null Het
Lrit2 T C 14: 37,072,124 W382R probably damaging Het
Mcee T A 7: 64,411,968 V173E probably damaging Het
Mcph1 T A 8: 18,632,326 V493E probably benign Het
Mfap4 A G 11: 61,487,087 N118D probably damaging Het
Mknk2 T C 10: 80,668,566 S301G probably benign Het
Mlf1 G A 3: 67,392,933 M94I possibly damaging Het
Mrc2 T A 11: 105,332,295 S455T possibly damaging Het
Mrgprb5 T G 7: 48,168,259 I243L probably benign Het
Muc4 C A 16: 32,760,105 P360T Het
Nat10 G A 2: 103,743,090 A354V probably damaging Het
Nts T C 10: 102,490,304 Q7R possibly damaging Het
Oas1b T C 5: 120,821,414 L288P probably damaging Het
Olfr1076 A G 2: 86,508,943 I161M possibly damaging Het
Olfr1131 A G 2: 87,629,092 I94V probably benign Het
Olfr1196 T A 2: 88,700,886 I148L probably benign Het
Olfr633 A T 7: 103,946,943 I126F probably damaging Het
Otoa A G 7: 121,145,626 E869G probably damaging Het
Pcdhac2 T C 18: 37,144,525 L186P probably damaging Het
Plekhh2 A G 17: 84,610,776 E1271G possibly damaging Het
Pmepa1 C T 2: 173,276,163 A8T probably benign Het
Rc3h2 A G 2: 37,377,849 probably null Het
Rlf T A 4: 121,146,801 M1771L possibly damaging Het
Rpap1 G A 2: 119,764,410 P1372L possibly damaging Het
Rragd A T 4: 32,983,527 D22V probably benign Het
Sema3f A T 9: 107,683,575 S644R probably benign Het
Sp110 G A 1: 85,579,092 R417C probably benign Het
Specc1l T A 10: 75,257,869 N717K probably damaging Het
Sphkap C T 1: 83,278,928 D367N possibly damaging Het
Tbc1d21 C T 9: 58,361,261 V272M probably damaging Het
Tmem132c A G 5: 127,563,006 D747G probably damaging Het
Tmem56 A G 3: 121,235,041 probably null Het
Trim2 C A 3: 84,190,906 V372F probably benign Het
Ttc34 A G 4: 154,861,384 T292A probably benign Het
Ube3b A G 5: 114,415,323 T919A probably benign Het
Wdr34 T G 2: 30,031,768 D527A probably benign Het
Zfhx4 T C 3: 5,412,480 I3385T probably benign Het
Zfp423 T C 8: 87,781,277 K813R probably damaging Het
Zfp850 T C 7: 27,989,209 T525A probably benign Het
Zfp873 T C 10: 82,060,275 I280T possibly damaging Het
Zkscan7 A G 9: 122,896,056 T697A possibly damaging Het
Other mutations in Atr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00640:Atr APN 9 95865052 missense probably damaging 1.00
IGL00922:Atr APN 9 95907345 missense probably damaging 0.97
IGL01020:Atr APN 9 95862783 missense probably damaging 1.00
IGL01345:Atr APN 9 95940949 missense probably damaging 1.00
IGL01364:Atr APN 9 95865624 missense probably benign 0.29
IGL01456:Atr APN 9 95950565 missense possibly damaging 0.62
IGL01534:Atr APN 9 95865546 missense probably damaging 0.99
IGL01761:Atr APN 9 95951448 splice site probably benign
IGL01791:Atr APN 9 95921781 missense probably benign 0.05
IGL01831:Atr APN 9 95870754 missense probably benign 0.18
IGL01973:Atr APN 9 95871674 missense probably damaging 1.00
IGL02008:Atr APN 9 95881420 splice site probably benign
IGL02016:Atr APN 9 95927175 missense probably benign 0.09
IGL02035:Atr APN 9 95866682 missense probably benign 0.01
IGL02058:Atr APN 9 95871487 missense probably damaging 0.99
IGL02081:Atr APN 9 95883205 missense probably damaging 1.00
IGL02224:Atr APN 9 95878629 missense probably damaging 0.98
IGL02234:Atr APN 9 95947250 splice site probably benign
IGL02367:Atr APN 9 95899141 nonsense probably null
IGL02621:Atr APN 9 95908400 missense probably benign 0.00
IGL02728:Atr APN 9 95936475 missense probably damaging 1.00
IGL02833:Atr APN 9 95862852 missense probably damaging 1.00
IGL02939:Atr APN 9 95865261 missense probably benign
IGL03107:Atr APN 9 95897730 missense probably benign 0.28
IGL03382:Atr APN 9 95920822 nonsense probably null
PIT4812001:Atr UTSW 9 95910649 missense probably benign 0.41
R0042:Atr UTSW 9 95927356 splice site probably benign
R0042:Atr UTSW 9 95927356 splice site probably benign
R0281:Atr UTSW 9 95937566 missense probably benign 0.26
R0282:Atr UTSW 9 95862798 missense probably benign 0.12
R0512:Atr UTSW 9 95935526 missense probably damaging 0.99
R0547:Atr UTSW 9 95899165 splice site probably benign
R0567:Atr UTSW 9 95865829 missense probably benign 0.00
R0631:Atr UTSW 9 95874777 missense possibly damaging 0.92
R1116:Atr UTSW 9 95867636 nonsense probably null
R1171:Atr UTSW 9 95907323 missense probably damaging 1.00
R1241:Atr UTSW 9 95950636 missense probably benign 0.08
R1345:Atr UTSW 9 95920355 missense probably benign 0.25
R1400:Atr UTSW 9 95862848 missense probably benign 0.32
R1413:Atr UTSW 9 95932442 missense probably damaging 1.00
R1527:Atr UTSW 9 95870043 missense possibly damaging 0.82
R1557:Atr UTSW 9 95871449 missense probably damaging 1.00
R1591:Atr UTSW 9 95945385 missense probably damaging 1.00
R1602:Atr UTSW 9 95951557 missense probably damaging 1.00
R1605:Atr UTSW 9 95936463 missense probably damaging 1.00
R1670:Atr UTSW 9 95861456 missense probably benign 0.38
R1709:Atr UTSW 9 95871076 missense probably benign 0.00
R1728:Atr UTSW 9 95897581 missense probably benign 0.01
R1729:Atr UTSW 9 95897581 missense probably benign 0.01
R1739:Atr UTSW 9 95897581 missense probably benign 0.01
R1816:Atr UTSW 9 95866694 missense probably benign 0.00
R1824:Atr UTSW 9 95936421 missense probably damaging 1.00
R1844:Atr UTSW 9 95905817 missense probably benign 0.01
R1857:Atr UTSW 9 95865097 missense probably damaging 1.00
R1858:Atr UTSW 9 95865097 missense probably damaging 1.00
R1866:Atr UTSW 9 95870605 splice site probably null
R1913:Atr UTSW 9 95866733 missense probably benign 0.01
R2042:Atr UTSW 9 95870022 missense probably benign 0.00
R2210:Atr UTSW 9 95907300 missense probably damaging 1.00
R2230:Atr UTSW 9 95920765 missense probably damaging 1.00
R2361:Atr UTSW 9 95871157 missense probably benign 0.41
R2399:Atr UTSW 9 95871599 missense probably benign 0.00
R2431:Atr UTSW 9 95862892 missense probably benign 0.24
R2860:Atr UTSW 9 95874243 missense probably benign 0.07
R2861:Atr UTSW 9 95874243 missense probably benign 0.07
R3019:Atr UTSW 9 95905818 missense possibly damaging 0.52
R3684:Atr UTSW 9 95920400 missense probably damaging 0.96
R4155:Atr UTSW 9 95888124 nonsense probably null
R4295:Atr UTSW 9 95874426 missense probably benign 0.04
R4359:Atr UTSW 9 95951536 missense probably damaging 1.00
R4506:Atr UTSW 9 95865237 missense probably benign 0.21
R4523:Atr UTSW 9 95862863 missense probably damaging 1.00
R4536:Atr UTSW 9 95874418 missense probably benign 0.26
R4588:Atr UTSW 9 95865667 missense probably benign
R4646:Atr UTSW 9 95871197 critical splice donor site probably null
R4702:Atr UTSW 9 95920355 missense possibly damaging 0.92
R4743:Atr UTSW 9 95862792 missense probably benign 0.14
R4782:Atr UTSW 9 95862797 missense probably benign 0.00
R4928:Atr UTSW 9 95907299 missense probably damaging 1.00
R5031:Atr UTSW 9 95865702 missense probably damaging 0.98
R5138:Atr UTSW 9 95937596 missense probably benign 0.15
R5188:Atr UTSW 9 95921725 missense probably benign 0.00
R5219:Atr UTSW 9 95881238 missense probably damaging 0.99
R5307:Atr UTSW 9 95878544 missense probably benign 0.01
R5414:Atr UTSW 9 95870704 missense probably benign 0.00
R5628:Atr UTSW 9 95874226 nonsense probably null
R5664:Atr UTSW 9 95905813 missense probably benign 0.00
R5678:Atr UTSW 9 95951487 nonsense probably null
R5724:Atr UTSW 9 95866588 missense probably damaging 1.00
R5759:Atr UTSW 9 95874402 missense probably benign 0.01
R5763:Atr UTSW 9 95945123 missense probably benign 0.04
R5922:Atr UTSW 9 95903682 missense probably benign 0.00
R6051:Atr UTSW 9 95908369 missense possibly damaging 0.85
R6161:Atr UTSW 9 95865319 missense probably benign
R6171:Atr UTSW 9 95881271 nonsense probably null
R6532:Atr UTSW 9 95908408 missense probably benign
R6774:Atr UTSW 9 95927213 missense probably benign 0.00
R6894:Atr UTSW 9 95927197 missense probably damaging 1.00
R6930:Atr UTSW 9 95866635 missense probably benign 0.21
R7018:Atr UTSW 9 95866694 missense probably benign 0.17
R7056:Atr UTSW 9 95862863 missense probably damaging 1.00
R7103:Atr UTSW 9 95865372 missense probably damaging 0.98
R7154:Atr UTSW 9 95865045 missense probably benign
R7157:Atr UTSW 9 95869900 missense probably benign 0.00
R7188:Atr UTSW 9 95862791 nonsense probably null
R7189:Atr UTSW 9 95862791 nonsense probably null
R7300:Atr UTSW 9 95865370 missense probably benign 0.00
R7337:Atr UTSW 9 95871448 missense probably damaging 1.00
R7584:Atr UTSW 9 95942713 missense probably damaging 1.00
R7602:Atr UTSW 9 95907383 missense possibly damaging 0.64
R7633:Atr UTSW 9 95947118 missense probably damaging 1.00
R7677:Atr UTSW 9 95885462 missense probably damaging 1.00
R7699:Atr UTSW 9 95875690 nonsense probably null
R7700:Atr UTSW 9 95875690 nonsense probably null
R7790:Atr UTSW 9 95874180 missense probably damaging 1.00
R8027:Atr UTSW 9 95865756 missense probably damaging 0.99
R8147:Atr UTSW 9 95899060 missense probably damaging 1.00
R8204:Atr UTSW 9 95935513 missense
R8306:Atr UTSW 9 95920370 missense
R8462:Atr UTSW 9 95867526 missense probably benign
R8716:Atr UTSW 9 95907415 missense probably benign 0.09
R8748:Atr UTSW 9 95932423 missense probably benign 0.00
R8795:Atr UTSW 9 95867531 missense probably damaging 1.00
R8891:Atr UTSW 9 95905760 missense probably benign 0.03
R8976:Atr UTSW 9 95890766 missense probably benign 0.00
R9024:Atr UTSW 9 95907363 missense possibly damaging 0.93
R9116:Atr UTSW 9 95865798 missense probably benign 0.00
R9523:Atr UTSW 9 95910557 missense possibly damaging 0.89
R9524:Atr UTSW 9 95910557 missense possibly damaging 0.89
R9525:Atr UTSW 9 95910557 missense possibly damaging 0.89
R9527:Atr UTSW 9 95885376 missense probably damaging 1.00
R9563:Atr UTSW 9 95920780 missense probably damaging 0.98
R9629:Atr UTSW 9 95865045 missense probably benign
R9642:Atr UTSW 9 95939241 missense probably damaging 1.00
R9652:Atr UTSW 9 95874834 missense probably damaging 1.00
R9660:Atr UTSW 9 95914997 missense probably benign 0.40
R9678:Atr UTSW 9 95910557 missense possibly damaging 0.89
R9728:Atr UTSW 9 95914997 missense probably benign 0.40
R9731:Atr UTSW 9 95865039 missense possibly damaging 0.52
R9732:Atr UTSW 9 95861385 missense probably damaging 1.00
R9749:Atr UTSW 9 95937650 critical splice donor site probably null
X0019:Atr UTSW 9 95940871 missense probably damaging 1.00
Z1088:Atr UTSW 9 95885320 splice site probably null
Z1177:Atr UTSW 9 95888100 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTAGCAGCTACATTCCCACTAG -3'
(R):5'- GTTCAGAACTCAAGTCACATGTC -3'

Sequencing Primer
(F):5'- ACTAGGATCTCAGTACTTTTGGC -3'
(R):5'- TCAAGTCACATGTCTGGAAACC -3'
Posted On 2020-03-06