Incidental Mutation 'R7640:Sema3f'
ID 628329
Institutional Source Beutler Lab
Gene Symbol Sema3f
Ensembl Gene ENSMUSG00000034684
Gene Name sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F
Synonyms Sema IV, Semak
MMRRC Submission 045698-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7640 (G1)
Quality Score 52.0072
Status Validated
Chromosome 9
Chromosomal Location 107558699-107587674 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 107560774 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 644 (S644R)
Ref Sequence ENSEMBL: ENSMUSP00000141865 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010205] [ENSMUST00000080560] [ENSMUST00000192271] [ENSMUST00000192727] [ENSMUST00000192783] [ENSMUST00000193108] [ENSMUST00000194039]
AlphaFold O88632
Predicted Effect probably benign
Transcript: ENSMUST00000010205
SMART Domains Protein: ENSMUSP00000010205
Gene: ENSMUSG00000034837

DomainStartEndE-ValueType
G_alpha 9 349 5.13e-223 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000080560
AA Change: S613R

PolyPhen 2 Score 0.434 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000079400
Gene: ENSMUSG00000034684
AA Change: S613R

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Sema 57 498 5.46e-206 SMART
PSI 516 568 1.87e-12 SMART
IGc2 586 654 3.79e-4 SMART
low complexity region 673 695 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192271
SMART Domains Protein: ENSMUSP00000141571
Gene: ENSMUSG00000034837

DomainStartEndE-ValueType
low complexity region 14 27 N/A INTRINSIC
transmembrane domain 32 49 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192727
AA Change: S644R

PolyPhen 2 Score 0.196 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000141865
Gene: ENSMUSG00000034684
AA Change: S644R

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Sema 57 529 3.31e-205 SMART
PSI 547 599 1.87e-12 SMART
IGc2 617 685 3.79e-4 SMART
low complexity region 704 726 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192783
SMART Domains Protein: ENSMUSP00000141668
Gene: ENSMUSG00000034684

DomainStartEndE-ValueType
Sema 1 276 3.6e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193108
SMART Domains Protein: ENSMUSP00000141878
Gene: ENSMUSG00000034684

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Sema 57 191 9.9e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000194039
SMART Domains Protein: ENSMUSP00000142221
Gene: ENSMUSG00000034684

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Sema 57 185 2e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000194424
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the semaphorin III family of secreted signaling proteins that are involved in axon guidance during neuronal development. The encoded protein contains an N-terminal Sema domain, an immunoglobulin loop and a C-terminal basic domain. This gene is expressed by the endothelial cells where it was found to act in an autocrine fashion to induce apoptosis, inhibit cell proliferation and survival, and function as an anti-tumorigenic agent. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2016]
PHENOTYPE: Inactivation of this locus results in neuronal defects including impaired CNS axon pathfinding, and PNS and limbic system circuitry. Mice homozygous for a knock-out allele exhibit increased lymphatic branching complexity and LEC numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik A T 4: 137,181,905 (GRCm39) N20I probably damaging Het
4930558K02Rik A G 1: 161,784,718 (GRCm39) S74P probably benign Het
Abcb6 A T 1: 75,151,489 (GRCm39) probably null Het
Adamts14 C A 10: 61,081,836 (GRCm39) A234S probably benign Het
Ankrd42 A G 7: 92,268,843 (GRCm39) S167P probably benign Het
Ap3m1 T C 14: 21,088,243 (GRCm39) I272V probably benign Het
Armt1 T C 10: 4,403,572 (GRCm39) F219S probably damaging Het
Atr T G 9: 95,789,346 (GRCm39) probably null Het
Cep72 G A 13: 74,206,607 (GRCm39) Q72* probably null Het
Clock G T 5: 76,396,225 (GRCm39) L175M possibly damaging Het
Cnmd T A 14: 79,898,974 (GRCm39) Y26F possibly damaging Het
Col6a6 A T 9: 105,662,943 (GRCm39) M198K possibly damaging Het
Cuta C T 17: 27,157,396 (GRCm39) V135I probably benign Het
Ddx41 A T 13: 55,682,052 (GRCm39) M241K possibly damaging Het
Dnajc22 A G 15: 98,998,995 (GRCm39) N60S probably damaging Het
Drc3 A G 11: 60,279,730 (GRCm39) M432V probably benign Het
Dync2i2 T G 2: 29,921,780 (GRCm39) D527A probably benign Het
Eef1d C A 15: 75,774,556 (GRCm39) G368C probably damaging Het
En2 A T 5: 28,375,164 (GRCm39) K236* probably null Het
Fas A G 19: 34,284,564 (GRCm39) T24A possibly damaging Het
Golga2 T C 2: 32,196,251 (GRCm39) V930A probably benign Het
Gprin2 G T 14: 33,917,710 (GRCm39) A20D probably benign Het
Ighv14-4 A T 12: 114,140,064 (GRCm39) C115* probably null Het
Impdh2 T C 9: 108,442,380 (GRCm39) Y459H possibly damaging Het
Klhdc7b G T 15: 89,271,463 (GRCm39) V124L possibly damaging Het
L2hgdh A T 12: 69,768,131 (GRCm39) Y122* probably null Het
Lamc2 A T 1: 153,012,550 (GRCm39) I708N possibly damaging Het
Large2 T C 2: 92,205,050 (GRCm39) M1V probably null Het
Lrit2 T C 14: 36,794,081 (GRCm39) W382R probably damaging Het
Mcee T A 7: 64,061,716 (GRCm39) V173E probably damaging Het
Mcph1 T A 8: 18,682,342 (GRCm39) V493E probably benign Het
Mfap4 A G 11: 61,377,913 (GRCm39) N118D probably damaging Het
Mknk2 T C 10: 80,504,400 (GRCm39) S301G probably benign Het
Mlf1 G A 3: 67,300,266 (GRCm39) M94I possibly damaging Het
Mrc2 T A 11: 105,223,121 (GRCm39) S455T possibly damaging Het
Mrgprb5 T G 7: 47,818,007 (GRCm39) I243L probably benign Het
Muc4 C A 16: 32,580,479 (GRCm39) P360T Het
Nat10 G A 2: 103,573,435 (GRCm39) A354V probably damaging Het
Nscme3l T A 19: 5,553,035 (GRCm39) S249C probably damaging Het
Nts T C 10: 102,326,165 (GRCm39) Q7R possibly damaging Het
Oas1b T C 5: 120,959,479 (GRCm39) L288P probably damaging Het
Or4a66 T A 2: 88,531,230 (GRCm39) I148L probably benign Het
Or51k2 A T 7: 103,596,150 (GRCm39) I126F probably damaging Het
Or5w11 A G 2: 87,459,436 (GRCm39) I94V probably benign Het
Or8k30 A G 2: 86,339,287 (GRCm39) I161M possibly damaging Het
Otoa A G 7: 120,744,849 (GRCm39) E869G probably damaging Het
Pcdhac2 T C 18: 37,277,578 (GRCm39) L186P probably damaging Het
Plekhh2 A G 17: 84,918,204 (GRCm39) E1271G possibly damaging Het
Pmepa1 C T 2: 173,117,956 (GRCm39) A8T probably benign Het
Pramel24 T C 4: 143,453,276 (GRCm39) V128A probably benign Het
Rc3h2 A G 2: 37,267,861 (GRCm39) probably null Het
Rlf T A 4: 121,003,998 (GRCm39) M1771L possibly damaging Het
Rpap1 G A 2: 119,594,891 (GRCm39) P1372L possibly damaging Het
Rragd A T 4: 32,983,527 (GRCm39) D22V probably benign Het
Sp110 G A 1: 85,506,813 (GRCm39) R417C probably benign Het
Spata31h1 T A 10: 82,130,490 (GRCm39) N840I probably damaging Het
Specc1l T A 10: 75,093,703 (GRCm39) N717K probably damaging Het
Sphkap C T 1: 83,256,649 (GRCm39) D367N possibly damaging Het
Tbc1d21 C T 9: 58,268,544 (GRCm39) V272M probably damaging Het
Tlcd4 A G 3: 121,028,690 (GRCm39) probably null Het
Tmem132c A G 5: 127,640,070 (GRCm39) D747G probably damaging Het
Trim2 C A 3: 84,098,213 (GRCm39) V372F probably benign Het
Ttc34 A G 4: 154,945,841 (GRCm39) T292A probably benign Het
Ube3b A G 5: 114,553,384 (GRCm39) T919A probably benign Het
Zfhx4 T C 3: 5,477,540 (GRCm39) I3385T probably benign Het
Zfp423 T C 8: 88,507,905 (GRCm39) K813R probably damaging Het
Zfp850 T C 7: 27,688,634 (GRCm39) T525A probably benign Het
Zfp873 T C 10: 81,896,109 (GRCm39) I280T possibly damaging Het
Zkscan7 A G 9: 122,725,121 (GRCm39) T697A possibly damaging Het
Other mutations in Sema3f
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00945:Sema3f APN 9 107,562,721 (GRCm39) missense probably benign 0.44
IGL01940:Sema3f APN 9 107,560,896 (GRCm39) unclassified probably benign
IGL02070:Sema3f APN 9 107,569,440 (GRCm39) missense probably damaging 1.00
IGL02381:Sema3f APN 9 107,569,594 (GRCm39) missense probably damaging 1.00
IGL02472:Sema3f APN 9 107,564,935 (GRCm39) missense probably damaging 1.00
IGL02557:Sema3f APN 9 107,564,411 (GRCm39) missense probably damaging 1.00
IGL02614:Sema3f APN 9 107,559,710 (GRCm39) missense probably benign 0.28
IGL02660:Sema3f APN 9 107,561,183 (GRCm39) missense probably benign 0.05
R1468:Sema3f UTSW 9 107,564,771 (GRCm39) unclassified probably benign
R1905:Sema3f UTSW 9 107,561,575 (GRCm39) missense probably damaging 1.00
R4728:Sema3f UTSW 9 107,582,639 (GRCm39) missense probably benign 0.00
R4772:Sema3f UTSW 9 107,566,919 (GRCm39) nonsense probably null
R4786:Sema3f UTSW 9 107,559,881 (GRCm39) missense probably benign 0.45
R4845:Sema3f UTSW 9 107,562,700 (GRCm39) missense probably damaging 1.00
R5418:Sema3f UTSW 9 107,569,820 (GRCm39) missense probably damaging 1.00
R5780:Sema3f UTSW 9 107,559,788 (GRCm39) missense probably damaging 0.98
R5849:Sema3f UTSW 9 107,559,815 (GRCm39) missense probably damaging 0.98
R5929:Sema3f UTSW 9 107,569,392 (GRCm39) missense probably damaging 1.00
R6968:Sema3f UTSW 9 107,568,648 (GRCm39) critical splice acceptor site probably null
R7043:Sema3f UTSW 9 107,568,599 (GRCm39) missense possibly damaging 0.91
R7449:Sema3f UTSW 9 107,561,235 (GRCm39) missense probably damaging 1.00
R7526:Sema3f UTSW 9 107,566,927 (GRCm39) missense probably damaging 0.96
R7559:Sema3f UTSW 9 107,561,777 (GRCm39) missense possibly damaging 0.52
R7771:Sema3f UTSW 9 107,569,625 (GRCm39) missense possibly damaging 0.89
R7789:Sema3f UTSW 9 107,582,631 (GRCm39) missense probably benign 0.00
R8058:Sema3f UTSW 9 107,559,800 (GRCm39) missense probably benign 0.42
R8113:Sema3f UTSW 9 107,565,275 (GRCm39) missense possibly damaging 0.95
R9574:Sema3f UTSW 9 107,566,972 (GRCm39) missense possibly damaging 0.50
R9641:Sema3f UTSW 9 107,565,454 (GRCm39) missense unknown
R9674:Sema3f UTSW 9 107,566,947 (GRCm39) missense possibly damaging 0.69
R9799:Sema3f UTSW 9 107,562,562 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTATAACCCCGACAGAGTAC -3'
(R):5'- AGGAAGCCACCTCAATGGAG -3'

Sequencing Primer
(F):5'- GAACTTGCTCTGTAGACCAGACTG -3'
(R):5'- TCAATGGAGAGTCACCCAGCG -3'
Posted On 2020-03-06