Incidental Mutation 'R7647:Sgcb'
ID628330
Institutional Source Beutler Lab
Gene Symbol Sgcb
Ensembl Gene ENSMUSG00000029156
Gene Namesarcoglycan, beta (dystrophin-associated glycoprotein)
Synonymsbeta-SG
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.175) question?
Stock #R7647 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location73632749-73647790 bp(-) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) A to T at 73639377 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000079937 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081170]
Predicted Effect probably null
Transcript: ENSMUST00000081170
SMART Domains Protein: ENSMUSP00000079937
Gene: ENSMUSG00000029156

DomainStartEndE-ValueType
Pfam:Sarcoglycan_1 56 305 4.3e-67 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sarcoglycan family. Sarcoglycans are transmembrane components in the dystrophin-glycoprotein complex which help stabilize the muscle fiber membranes and link the muscle cytoskeleton to the extracellular matrix. Mutations in this gene have been associated with limb-girdle muscular dystrophy.[provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit muscular dystrophy and cardiomyopathy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730507C01Rik C A 12: 18,514,802 T22K possibly damaging Het
9530053A07Rik A G 7: 28,140,045 K428E probably benign Het
Abca7 G T 10: 80,000,822 M344I probably benign Het
Alg14 T C 3: 121,361,685 S185P probably damaging Het
Atg13 A T 2: 91,688,661 H146Q possibly damaging Het
Atmin T G 8: 116,957,922 F774V possibly damaging Het
Ccdc150 A G 1: 54,356,704 D782G probably damaging Het
Ccdc86 A G 19: 10,948,999 S79P unknown Het
Cd180 A T 13: 102,705,943 E499V probably damaging Het
Cd24a C T 10: 43,582,751 H73Y unknown Het
Cdh17 C T 4: 11,814,698 P751L probably damaging Het
Chil3 A G 3: 106,148,806 L344S possibly damaging Het
Cspp1 A G 1: 10,135,937 D1129G probably benign Het
Cyth1 C A 11: 118,177,288 V288L probably benign Het
Ddx19a A T 8: 110,976,627 probably null Het
Dpysl4 T A 7: 139,099,773 Y520N possibly damaging Het
Eif4b T A 15: 102,088,694 M249K unknown Het
Enam G A 5: 88,503,025 D798N probably benign Het
Gldc A G 19: 30,118,667 V648A probably damaging Het
Gm7995 A G 14: 42,311,351 I62V possibly damaging Het
Ice1 A G 13: 70,589,797 V2177A possibly damaging Het
Kdm5a T A 6: 120,427,786 S1330T probably benign Het
Mon2 G T 10: 123,006,026 P1553Q probably benign Het
Mylk G C 16: 34,879,524 S419T probably benign Het
Nphs1 T A 7: 30,481,965 probably null Het
Nsd1 A G 13: 55,299,835 T1924A probably damaging Het
Obscn T A 11: 58,997,287 probably null Het
Olfr323 A T 11: 58,625,203 V281D probably damaging Het
Olfr651 T C 7: 104,553,686 F256L probably benign Het
Olfr782 T C 10: 129,351,457 V298A probably benign Het
Olfr806 A T 10: 129,738,201 C239S probably damaging Het
Pcsk1 A G 13: 75,132,210 D718G possibly damaging Het
Pitrm1 A T 13: 6,555,408 N158I probably damaging Het
Pkd1l1 C T 11: 8,947,296 V538M Het
Prkdc G T 16: 15,737,943 G2194C probably damaging Het
Psmc5 T C 11: 106,261,607 M150T possibly damaging Het
Rint1 T C 5: 23,800,802 Y161H probably damaging Het
Sdk2 T C 11: 113,793,737 K1966R probably damaging Het
Slc4a7 G A 14: 14,773,348 E773K probably benign Het
Sp100 A G 1: 85,692,043 K353E possibly damaging Het
Ssh1 T C 5: 113,942,958 T804A probably benign Het
Vipr1 T C 9: 121,653,839 L40P possibly damaging Het
Vmn1r7 A G 6: 57,025,270 S2P probably benign Het
Vwa8 T C 14: 78,935,229 S304P probably damaging Het
Zbed4 T C 15: 88,781,721 M664T probably damaging Het
Other mutations in Sgcb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Sgcb APN 5 73635678 missense possibly damaging 0.92
IGL02504:Sgcb APN 5 73644375 missense probably damaging 0.96
IGL03330:Sgcb APN 5 73639869 missense probably damaging 1.00
PIT4445001:Sgcb UTSW 5 73639812 missense probably damaging 0.99
R0708:Sgcb UTSW 5 73640882 splice site probably null
R1016:Sgcb UTSW 5 73639840 missense probably benign 0.18
R1119:Sgcb UTSW 5 73644414 missense probably damaging 1.00
R1293:Sgcb UTSW 5 73635527 missense probably benign 0.13
R1464:Sgcb UTSW 5 73635553 missense probably benign 0.05
R1464:Sgcb UTSW 5 73635553 missense probably benign 0.05
R2762:Sgcb UTSW 5 73635709 splice site probably null
R5499:Sgcb UTSW 5 73644405 missense probably damaging 0.99
R6120:Sgcb UTSW 5 73640810 missense possibly damaging 0.62
R6809:Sgcb UTSW 5 73640693 missense probably benign 0.03
R7484:Sgcb UTSW 5 73639845 missense possibly damaging 0.86
R8797:Sgcb UTSW 5 73635693 missense probably benign 0.00
R8939:Sgcb UTSW 5 73644318 missense probably damaging 0.98
Z1177:Sgcb UTSW 5 73644285 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AACTGCACATGCTCTGAAAGAAATG -3'
(R):5'- TAGTCCAGAGTTGAGACACCC -3'

Sequencing Primer
(F):5'- TTCCACATACTACTCCACAT -3'
(R):5'- GAGTTGAGACACCCCCTTC -3'
Posted On2020-03-06