Incidental Mutation 'R7647:Nphs1'
ID 628331
Institutional Source Beutler Lab
Gene Symbol Nphs1
Ensembl Gene ENSMUSG00000006649
Gene Name nephrosis 1, nephrin
Synonyms nephrin
MMRRC Submission 045725-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7647 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 30157740-30186648 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to A at 30181390 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116500 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006825] [ENSMUST00000126297]
AlphaFold Q9QZS7
Predicted Effect probably null
Transcript: ENSMUST00000006825
SMART Domains Protein: ENSMUSP00000006825
Gene: ENSMUSG00000006649

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
IG 52 146 1.38e-6 SMART
Pfam:C2-set_2 152 242 4.1e-20 PFAM
IG 264 351 9.86e-3 SMART
IG_like 360 452 2.73e1 SMART
IG 464 556 2.99e-2 SMART
IG_like 572 644 8.9e-1 SMART
IG 667 751 1.32e-3 SMART
IG 760 849 7.3e-6 SMART
IGc2 868 941 5.4e-9 SMART
FN3 955 1036 1.01e-11 SMART
transmembrane domain 1078 1100 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000126297
SMART Domains Protein: ENSMUSP00000116500
Gene: ENSMUSG00000006649

DomainStartEndE-ValueType
IG 38 132 1.38e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149086
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the immunoglobulin family of cell adhesion molecules that functions in the glomerular filtration barrier in the kidney. The gene is primarily expressed in renal tissues, and the protein is a type-1 transmembrane protein found at the slit diaphragm of glomerular podocytes. The slit diaphragm is thought to function as an ultrafilter to exclude albumin and other plasma macromolecules in the formation of urine. Mutations in this gene result in Finnish-type congenital nephrosis 1, characterized by severe proteinuria and loss of the slit diaphragm and foot processes.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit severe proteinuria associated with kidney defects and die soon after birth. Heterozygotes exhibit fusion of one-third of glomerular foot processes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730507C01Rik C A 12: 18,564,803 (GRCm39) T22K possibly damaging Het
Abca7 G T 10: 79,836,656 (GRCm39) M344I probably benign Het
Alg14 T C 3: 121,155,334 (GRCm39) S185P probably damaging Het
Atg13 A T 2: 91,519,006 (GRCm39) H146Q possibly damaging Het
Atmin T G 8: 117,684,661 (GRCm39) F774V possibly damaging Het
Ccdc150 A G 1: 54,395,863 (GRCm39) D782G probably damaging Het
Ccdc86 A G 19: 10,926,363 (GRCm39) S79P unknown Het
Cd180 A T 13: 102,842,451 (GRCm39) E499V probably damaging Het
Cd24a C T 10: 43,458,747 (GRCm39) H73Y unknown Het
Cdh17 C T 4: 11,814,698 (GRCm39) P751L probably damaging Het
Chil3 A G 3: 106,056,122 (GRCm39) L344S possibly damaging Het
Cspp1 A G 1: 10,206,162 (GRCm39) D1129G probably benign Het
Cyth1 C A 11: 118,068,114 (GRCm39) V288L probably benign Het
Ddx19a A T 8: 111,703,259 (GRCm39) probably null Het
Dpysl4 T A 7: 138,679,689 (GRCm39) Y520N possibly damaging Het
Eif4b T A 15: 101,997,129 (GRCm39) M249K unknown Het
Enam G A 5: 88,650,884 (GRCm39) D798N probably benign Het
Fcgbpl1 A G 7: 27,839,470 (GRCm39) K428E probably benign Het
Gldc A G 19: 30,096,067 (GRCm39) V648A probably damaging Het
Gm7995 A G 14: 42,133,308 (GRCm39) I62V possibly damaging Het
Ice1 A G 13: 70,737,916 (GRCm39) V2177A possibly damaging Het
Kdm5a T A 6: 120,404,747 (GRCm39) S1330T probably benign Het
Mon2 G T 10: 122,841,931 (GRCm39) P1553Q probably benign Het
Mylk G C 16: 34,699,894 (GRCm39) S419T probably benign Het
Nsd1 A G 13: 55,447,648 (GRCm39) T1924A probably damaging Het
Obscn T A 11: 58,888,113 (GRCm39) probably null Het
Or11l3 A T 11: 58,516,029 (GRCm39) V281D probably damaging Het
Or52h9 T C 7: 104,202,893 (GRCm39) F256L probably benign Het
Or6c213 A T 10: 129,574,070 (GRCm39) C239S probably damaging Het
Or6c6 T C 10: 129,187,326 (GRCm39) V298A probably benign Het
Pcsk1 A G 13: 75,280,329 (GRCm39) D718G possibly damaging Het
Pitrm1 A T 13: 6,605,444 (GRCm39) N158I probably damaging Het
Pkd1l1 C T 11: 8,897,296 (GRCm39) V538M Het
Prkdc G T 16: 15,555,807 (GRCm39) G2194C probably damaging Het
Psmc5 T C 11: 106,152,433 (GRCm39) M150T possibly damaging Het
Rint1 T C 5: 24,005,800 (GRCm39) Y161H probably damaging Het
Sdk2 T C 11: 113,684,563 (GRCm39) K1966R probably damaging Het
Sgcb A T 5: 73,796,720 (GRCm39) probably null Het
Slc4a7 G A 14: 14,773,348 (GRCm38) E773K probably benign Het
Sp100 A G 1: 85,619,764 (GRCm39) K353E possibly damaging Het
Ssh1 T C 5: 114,081,019 (GRCm39) T804A probably benign Het
Vipr1 T C 9: 121,482,905 (GRCm39) L40P possibly damaging Het
Vmn1r7 A G 6: 57,002,255 (GRCm39) S2P probably benign Het
Vwa8 T C 14: 79,172,669 (GRCm39) S304P probably damaging Het
Zbed4 T C 15: 88,665,924 (GRCm39) M664T probably damaging Het
Other mutations in Nphs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Nphs1 APN 7 30,181,976 (GRCm39) missense possibly damaging 0.77
IGL00927:Nphs1 APN 7 30,160,164 (GRCm39) unclassified probably benign
IGL00976:Nphs1 APN 7 30,160,110 (GRCm39) missense possibly damaging 0.78
IGL01397:Nphs1 APN 7 30,186,089 (GRCm39) missense probably benign 0.01
IGL01465:Nphs1 APN 7 30,186,139 (GRCm39) makesense probably null
IGL01889:Nphs1 APN 7 30,159,936 (GRCm39) missense probably damaging 1.00
IGL02383:Nphs1 APN 7 30,181,060 (GRCm39) splice site probably benign
R0020:Nphs1 UTSW 7 30,162,633 (GRCm39) missense probably benign 0.01
R0485:Nphs1 UTSW 7 30,166,940 (GRCm39) missense probably benign
R1024:Nphs1 UTSW 7 30,173,702 (GRCm39) missense probably damaging 1.00
R1115:Nphs1 UTSW 7 30,180,803 (GRCm39) splice site probably benign
R1144:Nphs1 UTSW 7 30,181,103 (GRCm39) splice site probably benign
R1289:Nphs1 UTSW 7 30,170,603 (GRCm39) missense probably damaging 1.00
R1317:Nphs1 UTSW 7 30,181,256 (GRCm39) splice site probably benign
R1617:Nphs1 UTSW 7 30,181,956 (GRCm39) missense probably benign
R1756:Nphs1 UTSW 7 30,160,959 (GRCm39) missense probably benign 0.00
R1937:Nphs1 UTSW 7 30,173,798 (GRCm39) missense probably damaging 1.00
R2144:Nphs1 UTSW 7 30,160,395 (GRCm39) missense probably benign 0.13
R2256:Nphs1 UTSW 7 30,167,417 (GRCm39) missense possibly damaging 0.94
R2257:Nphs1 UTSW 7 30,167,417 (GRCm39) missense possibly damaging 0.94
R2277:Nphs1 UTSW 7 30,166,989 (GRCm39) nonsense probably null
R3104:Nphs1 UTSW 7 30,166,965 (GRCm39) nonsense probably null
R3106:Nphs1 UTSW 7 30,166,965 (GRCm39) nonsense probably null
R3151:Nphs1 UTSW 7 30,159,665 (GRCm39) missense probably benign
R3765:Nphs1 UTSW 7 30,170,635 (GRCm39) missense probably damaging 0.98
R4078:Nphs1 UTSW 7 30,166,945 (GRCm39) nonsense probably null
R4397:Nphs1 UTSW 7 30,181,390 (GRCm39) splice site probably null
R4635:Nphs1 UTSW 7 30,167,432 (GRCm39) missense probably benign 0.39
R4650:Nphs1 UTSW 7 30,181,895 (GRCm39) missense probably benign 0.21
R4811:Nphs1 UTSW 7 30,159,854 (GRCm39) missense probably damaging 1.00
R4850:Nphs1 UTSW 7 30,162,657 (GRCm39) missense possibly damaging 0.78
R5272:Nphs1 UTSW 7 30,181,067 (GRCm39) missense possibly damaging 0.86
R5327:Nphs1 UTSW 7 30,163,250 (GRCm39) missense probably benign 0.00
R5681:Nphs1 UTSW 7 30,186,050 (GRCm39) missense probably benign 0.00
R5865:Nphs1 UTSW 7 30,173,810 (GRCm39) missense probably damaging 1.00
R5975:Nphs1 UTSW 7 30,165,540 (GRCm39) missense possibly damaging 0.82
R6186:Nphs1 UTSW 7 30,165,059 (GRCm39) missense probably damaging 0.98
R6198:Nphs1 UTSW 7 30,167,340 (GRCm39) missense probably damaging 0.97
R6353:Nphs1 UTSW 7 30,173,969 (GRCm39) missense probably damaging 0.99
R7405:Nphs1 UTSW 7 30,162,253 (GRCm39) missense possibly damaging 0.46
R7767:Nphs1 UTSW 7 30,162,733 (GRCm39) missense probably damaging 1.00
R8132:Nphs1 UTSW 7 30,181,478 (GRCm39) missense probably benign 0.02
R8485:Nphs1 UTSW 7 30,165,598 (GRCm39) missense probably damaging 0.98
R8678:Nphs1 UTSW 7 30,163,284 (GRCm39) missense probably damaging 1.00
R8890:Nphs1 UTSW 7 30,162,080 (GRCm39) missense probably damaging 1.00
R8946:Nphs1 UTSW 7 30,162,625 (GRCm39) missense probably damaging 1.00
R9133:Nphs1 UTSW 7 30,160,092 (GRCm39) nonsense probably null
R9159:Nphs1 UTSW 7 30,165,026 (GRCm39) missense possibly damaging 0.93
R9347:Nphs1 UTSW 7 30,170,594 (GRCm39) missense probably damaging 1.00
R9547:Nphs1 UTSW 7 30,180,875 (GRCm39) missense probably benign 0.00
R9548:Nphs1 UTSW 7 30,180,875 (GRCm39) missense probably benign 0.00
R9607:Nphs1 UTSW 7 30,163,012 (GRCm39) missense probably damaging 1.00
R9626:Nphs1 UTSW 7 30,166,991 (GRCm39) missense probably benign 0.16
R9720:Nphs1 UTSW 7 30,165,499 (GRCm39) missense possibly damaging 0.83
R9733:Nphs1 UTSW 7 30,166,955 (GRCm39) missense probably damaging 1.00
X0028:Nphs1 UTSW 7 30,166,929 (GRCm39) missense probably null 0.01
Z1177:Nphs1 UTSW 7 30,170,328 (GRCm39) missense probably damaging 1.00
Z1186:Nphs1 UTSW 7 30,159,775 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCACTTTCGTCCTGGAAGG -3'
(R):5'- ACCTGTGAAGGCTGGAGTTG -3'

Sequencing Primer
(F):5'- TCGTCCTGGAAGGTCGGAG -3'
(R):5'- TGTCTGCCGTGATAAGAGCAACTC -3'
Posted On 2020-03-06