Incidental Mutation 'R7663:Dnah14'
ID628333
Institutional Source Beutler Lab
Gene Symbol Dnah14
Ensembl Gene ENSMUSG00000047369
Gene Namedynein, axonemal, heavy chain 14
SynonymsDnahc14, Gm980, LOC381311, A230079K17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock #R7663 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location181576559-181815774 bp(+) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) A to T at 181752155 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146843 (fasta)
Predicted Effect probably null
Transcript: ENSMUST00000208001
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. Two major classes of dyneins, axonemal and cytoplasmic, have been identified. DNAH14 is an axonemal dynein heavy chain (DHC) (Vaughan et al., 1996 [PubMed 8812413]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,066,126 T359A probably damaging Het
Abcd4 A C 12: 84,606,129 V433G probably damaging Het
Acot5 C A 12: 84,069,581 R39S probably damaging Het
Actl9 T C 17: 33,433,469 S168P probably damaging Het
Adam15 A G 3: 89,345,806 L237P probably damaging Het
Ahctf1 T C 1: 179,790,314 Q289R possibly damaging Het
Arid5b C T 10: 68,098,587 G495E probably benign Het
Armh1 C A 4: 117,213,741 A396S probably benign Het
Asah1 C T 8: 41,341,627 R385Q probably damaging Het
AW549877 T C 15: 3,988,683 Y170C probably damaging Het
Bicc1 T C 10: 70,946,590 T607A probably benign Het
Ccdc88a T C 11: 29,498,614 probably null Het
Cdhr4 A T 9: 107,998,772 R750* probably null Het
Cep290 T A 10: 100,554,536 probably null Het
Clca3a1 T A 3: 144,737,036 D749V probably benign Het
Clcn1 C T 6: 42,310,063 P685S possibly damaging Het
Clk1 A G 1: 58,421,160 S104P probably damaging Het
Commd10 T C 18: 47,086,256 V172A probably benign Het
Cyp2c69 A T 19: 39,877,509 C213* probably null Het
Dock2 C T 11: 34,721,027 G170R probably damaging Het
Fam186a T G 15: 99,945,069 H1098P probably benign Het
Flt1 T C 5: 147,655,120 T511A probably benign Het
Fmo1 A C 1: 162,836,297 I221S possibly damaging Het
Fthl17b C T X: 8,962,804 R9Q possibly damaging Het
Fthl17b C T X: 8,962,808 V8M possibly damaging Het
Ginm1 A T 10: 7,775,362 S93R possibly damaging Het
Gm10251 A C 14: 6,675,701 probably null Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Gys2 C T 6: 142,459,485 R192H probably damaging Het
H2bfm G A X: 136,927,722 R120K unknown Het
Hectd4 C A 5: 121,324,031 A987E probably benign Het
Herc2 G A 7: 56,136,685 V1593I probably benign Het
Ighv14-3 T C 12: 114,059,934 T88A probably benign Het
Jag2 T C 12: 112,913,666 D695G probably damaging Het
Kazn A T 4: 142,104,898 D663E Het
Krt79 T C 15: 101,931,843 D306G probably damaging Het
Lama1 T A 17: 67,780,880 C1498S Het
Ldb1 T C 19: 46,035,524 Y141C probably damaging Het
Lmnb2 T A 10: 80,904,739 E336V probably damaging Het
Lrp1b T A 2: 42,653,035 probably benign Het
Mug1 C A 6: 121,861,220 H470N possibly damaging Het
Mycbp2 T A 14: 103,191,609 Y2377F probably damaging Het
Neb T A 2: 52,230,047 Y721F Het
Ntf3 A G 6: 126,101,815 S243P probably damaging Het
Olfr1195 G C 2: 88,683,352 P127A probably damaging Het
Olfr1480 G T 19: 13,530,445 M301I probably damaging Het
Olfr593 T C 7: 103,212,445 M195T possibly damaging Het
Pdk1 G A 2: 71,875,398 probably null Het
Pdzd2 A G 15: 12,373,203 V2282A probably damaging Het
Piwil1 T C 5: 128,747,433 F517L probably benign Het
Plch2 T A 4: 154,991,162 T738S probably damaging Het
Plekhm3 G A 1: 64,883,208 R603W probably damaging Het
Pltp A T 2: 164,857,006 probably null Het
Prdm4 A G 10: 85,899,281 S666P probably damaging Het
Psmb3 G T 11: 97,712,492 R177L probably damaging Het
Ralgapa2 A G 2: 146,418,415 V764A probably benign Het
Rel T C 11: 23,742,713 D440G probably benign Het
Rims2 T A 15: 39,507,026 V952E probably damaging Het
Samd4b G T 7: 28,423,500 C44* probably null Het
Slamf8 C A 1: 172,588,038 V78F possibly damaging Het
Slc35a1 A T 4: 34,675,493 N111K possibly damaging Het
Slc7a5 A T 8: 121,887,535 Y264* probably null Het
Srsf2 T C 11: 116,852,294 S134G unknown Het
Stag1 T A 9: 100,738,138 M98K probably damaging Het
Trib1 T C 15: 59,651,713 S199P probably damaging Het
Txnip T C 3: 96,559,837 S276P possibly damaging Het
Vmn1r194 C T 13: 22,244,741 T176I not run Het
Vmn1r222 A G 13: 23,232,431 L204P possibly damaging Het
Vmn2r63 T A 7: 42,927,042 H449L probably benign Het
Vmn2r83 T A 10: 79,479,122 N401K probably damaging Het
Vmn2r87 T A 10: 130,472,185 H728L probably damaging Het
Zfp69 G A 4: 120,935,126 A151V probably benign Het
Zfp738 A G 13: 67,683,401 probably null Het
Zfp974 T C 7: 27,911,685 E205G possibly damaging Het
Other mutations in Dnah14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01086:Dnah14 APN 1 181752046 missense probably benign 0.17
IGL01764:Dnah14 APN 1 181744777 missense probably benign 0.00
IGL03218:Dnah14 APN 1 181755269 missense probably benign 0.02
IGL03290:Dnah14 APN 1 181763978 splice site probably benign
IGL03384:Dnah14 APN 1 181745949 missense probably benign 0.03
R0009:Dnah14 UTSW 1 181769407 splice site probably benign
R0125:Dnah14 UTSW 1 181752063 missense probably damaging 0.99
R0579:Dnah14 UTSW 1 181744747 missense possibly damaging 0.72
R0973:Dnah14 UTSW 1 181752145 missense probably damaging 1.00
R0973:Dnah14 UTSW 1 181752145 missense probably damaging 1.00
R0974:Dnah14 UTSW 1 181752145 missense probably damaging 1.00
R1609:Dnah14 UTSW 1 181750177 missense probably damaging 0.97
R1860:Dnah14 UTSW 1 181763960 missense probably damaging 1.00
R2050:Dnah14 UTSW 1 181752562 missense probably damaging 1.00
R2974:Dnah14 UTSW 1 181755241 critical splice acceptor site probably null
R4715:Dnah14 UTSW 1 181757223 missense probably damaging 1.00
R5076:Dnah14 UTSW 1 181757234 missense probably benign 0.01
R5424:Dnah14 UTSW 1 181763310 missense possibly damaging 0.95
R5808:Dnah14 UTSW 1 181741159 missense possibly damaging 0.72
R5997:Dnah14 UTSW 1 181770105 missense probably benign 0.00
R6052:Dnah14 UTSW 1 181666487 missense possibly damaging 0.50
R6061:Dnah14 UTSW 1 181709051 missense probably damaging 1.00
R6089:Dnah14 UTSW 1 181750154 missense probably damaging 1.00
R6092:Dnah14 UTSW 1 181621833 missense probably benign 0.13
R6145:Dnah14 UTSW 1 181666417 missense probably benign 0.00
R6163:Dnah14 UTSW 1 181666361 missense probably benign 0.33
R6246:Dnah14 UTSW 1 181680888 missense probably benign 0.00
R6302:Dnah14 UTSW 1 181601206 missense possibly damaging 0.96
R6306:Dnah14 UTSW 1 181585024 frame shift probably null
R6326:Dnah14 UTSW 1 181783556 missense probably damaging 1.00
R6348:Dnah14 UTSW 1 181626720 missense possibly damaging 0.83
R6367:Dnah14 UTSW 1 181755386 splice site probably null
R6376:Dnah14 UTSW 1 181605894 missense possibly damaging 0.79
R6389:Dnah14 UTSW 1 181651202 critical splice donor site probably null
R6433:Dnah14 UTSW 1 181651657 missense probably damaging 0.99
R6454:Dnah14 UTSW 1 181783705 missense probably damaging 1.00
R6476:Dnah14 UTSW 1 181744768 missense probably benign 0.26
R6523:Dnah14 UTSW 1 181643621 missense probably benign 0.00
R6529:Dnah14 UTSW 1 181666469 missense probably damaging 0.98
R6538:Dnah14 UTSW 1 181584985 missense unknown
R6546:Dnah14 UTSW 1 181738987 missense probably damaging 1.00
R6752:Dnah14 UTSW 1 181593452 missense probably benign 0.07
R6762:Dnah14 UTSW 1 181757259 missense probably damaging 1.00
R6786:Dnah14 UTSW 1 181641405 missense probably benign 0.21
R6849:Dnah14 UTSW 1 181808945 missense probably benign 0.00
R6877:Dnah14 UTSW 1 181628432 missense possibly damaging 0.82
R6912:Dnah14 UTSW 1 181750183 missense possibly damaging 0.83
R6919:Dnah14 UTSW 1 181585066 missense probably benign 0.04
R6924:Dnah14 UTSW 1 181627952 missense probably benign 0.04
R6957:Dnah14 UTSW 1 181785175 missense possibly damaging 0.92
R6980:Dnah14 UTSW 1 181648230 missense probably benign 0.00
R7018:Dnah14 UTSW 1 181626944 missense possibly damaging 0.55
R7046:Dnah14 UTSW 1 181623003 missense probably benign 0.01
R7058:Dnah14 UTSW 1 181698049 missense probably benign 0.00
R7068:Dnah14 UTSW 1 181769790 missense probably benign 0.35
R7115:Dnah14 UTSW 1 181720145 missense probably damaging 1.00
R7130:Dnah14 UTSW 1 181745958 nonsense probably null
R7165:Dnah14 UTSW 1 181704535 missense probably benign 0.00
R7169:Dnah14 UTSW 1 181702365 missense probably benign 0.00
R7184:Dnah14 UTSW 1 181704529 nonsense probably null
R7232:Dnah14 UTSW 1 181757363 missense probably damaging 1.00
R7260:Dnah14 UTSW 1 181706744 missense probably damaging 0.99
R7276:Dnah14 UTSW 1 181685807 missense probably benign 0.41
R7290:Dnah14 UTSW 1 181628174 missense probably benign 0.20
R7314:Dnah14 UTSW 1 181785254 splice site probably null
R7326:Dnah14 UTSW 1 181598403 missense probably benign 0.02
R7336:Dnah14 UTSW 1 181797734 missense probably damaging 0.96
R7363:Dnah14 UTSW 1 181690524 splice site probably null
R7371:Dnah14 UTSW 1 181626885 missense probably benign 0.05
R7376:Dnah14 UTSW 1 181763402 missense probably benign 0.03
R7418:Dnah14 UTSW 1 181616742 missense possibly damaging 0.92
R7473:Dnah14 UTSW 1 181752139 missense probably damaging 0.99
R7514:Dnah14 UTSW 1 181628067 missense probably damaging 0.96
R7555:Dnah14 UTSW 1 181770054 missense probably benign 0.26
R7641:Dnah14 UTSW 1 181707533 missense probably benign 0.01
R7674:Dnah14 UTSW 1 181707533 missense probably benign 0.01
R7680:Dnah14 UTSW 1 181685800 missense probably benign 0.15
R7709:Dnah14 UTSW 1 181702484 critical splice donor site probably null
R7842:Dnah14 UTSW 1 181627898 missense probably damaging 0.99
R7861:Dnah14 UTSW 1 181616759 missense probably damaging 1.00
R7988:Dnah14 UTSW 1 181783574 missense probably damaging 0.97
R8016:Dnah14 UTSW 1 181648311 missense probably benign 0.05
R8042:Dnah14 UTSW 1 181643631 critical splice donor site probably null
R8071:Dnah14 UTSW 1 181615894 missense possibly damaging 0.84
R8086:Dnah14 UTSW 1 181766232 missense probably damaging 1.00
R8095:Dnah14 UTSW 1 181806032 nonsense probably null
R8139:Dnah14 UTSW 1 181755288 missense probably damaging 1.00
R8176:Dnah14 UTSW 1 181657033 missense probably damaging 0.96
R8193:Dnah14 UTSW 1 181688205 missense probably damaging 1.00
R8197:Dnah14 UTSW 1 181690101 missense possibly damaging 0.94
R8209:Dnah14 UTSW 1 181795545 missense possibly damaging 0.69
R8226:Dnah14 UTSW 1 181795545 missense possibly damaging 0.69
R8251:Dnah14 UTSW 1 181664865 missense probably damaging 1.00
R8264:Dnah14 UTSW 1 181744792 missense probably damaging 0.99
R8284:Dnah14 UTSW 1 181773811 missense probably benign 0.03
R8289:Dnah14 UTSW 1 181716215 nonsense probably null
R8323:Dnah14 UTSW 1 181704544 missense probably benign 0.01
R8442:Dnah14 UTSW 1 181741284 missense probably damaging 0.97
R8458:Dnah14 UTSW 1 181806012 missense
R8507:Dnah14 UTSW 1 181641414 missense probably benign 0.02
R8509:Dnah14 UTSW 1 181814655 missense
RF007:Dnah14 UTSW 1 181685809 missense probably benign 0.00
RF012:Dnah14 UTSW 1 181627898 missense probably damaging 0.99
Z1176:Dnah14 UTSW 1 181757351 missense possibly damaging 0.83
Z1177:Dnah14 UTSW 1 181690320 missense probably benign 0.03
Z1177:Dnah14 UTSW 1 181763334 missense probably damaging 1.00
Z1177:Dnah14 UTSW 1 181766304 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTGCATCTCATGTGACATGTTC -3'
(R):5'- GCACCACAGTTTTCATAGGACAC -3'

Sequencing Primer
(F):5'- GTGACATGTTCTCCCTAACATACATG -3'
(R):5'- GACACATTTAAAAGAAGCATTGAGTC -3'
Posted On2020-03-06