Mutagenetix > Incidental Mutations

Incidental Mutation 'R7603:Lpin3'

628336

Institutional Source

Beutler Lab

Gene Symbol

Lpin3

Ensembl Gene

ENSMUSG00000027412

Gene Name

lipin 3

Synonyms

9130206L11Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7603 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

160880670-160906002 bp(+) (GRCm38)

Type of Mutation

splice site (3 bp from exon)

DNA Base Change (assembly)

G to T at 160903754 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000105083 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040872] [ENSMUST00000040872] [ENSMUST00000057169] [ENSMUST00000109454] [ENSMUST00000109455] [ENSMUST00000109455] [ENSMUST00000109456] [ENSMUST00000109456] [ENSMUST00000109457] [ENSMUST00000109457]

AlphaFold

Q99PI4

Predicted Effect

probably null
Transcript: ENSMUST00000040872

SMART Domains

Protein: ENSMUSP00000043053
Gene: ENSMUSG00000027412

Domain	Start	End	E-Value	Type
Pfam:Lipin_N	1	114	5.8e-52	PFAM
low complexity region	136	148	N/A	INTRINSIC
low complexity region	155	172	N/A	INTRINSIC
low complexity region	176	191	N/A	INTRINSIC
low complexity region	220	233	N/A	INTRINSIC
low complexity region	271	282	N/A	INTRINSIC
low complexity region	559	569	N/A	INTRINSIC
LNS2	637	793	1.4e-105	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000040872

SMART Domains

Protein: ENSMUSP00000043053
Gene: ENSMUSG00000027412

Domain	Start	End	E-Value	Type
Pfam:Lipin_N	1	114	5.8e-52	PFAM
low complexity region	136	148	N/A	INTRINSIC
low complexity region	155	172	N/A	INTRINSIC
low complexity region	176	191	N/A	INTRINSIC
low complexity region	220	233	N/A	INTRINSIC
low complexity region	271	282	N/A	INTRINSIC
low complexity region	559	569	N/A	INTRINSIC
LNS2	637	793	1.4e-105	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000057169

SMART Domains

Protein: ENSMUSP00000059732
Gene: ENSMUSG00000050700

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:EMI	55	125	7.3e-18	PFAM
low complexity region	144	161	N/A	INTRINSIC
low complexity region	281	295	N/A	INTRINSIC
low complexity region	359	381	N/A	INTRINSIC
low complexity region	451	460	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000109454

SMART Domains

Protein: ENSMUSP00000105080
Gene: ENSMUSG00000050700

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:EMI	54	127	6.4e-22	PFAM
low complexity region	144	161	N/A	INTRINSIC
low complexity region	234	248	N/A	INTRINSIC
low complexity region	312	334	N/A	INTRINSIC
low complexity region	404	413	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000109455

SMART Domains

Protein: ENSMUSP00000105081
Gene: ENSMUSG00000027412

Domain	Start	End	E-Value	Type
Pfam:Lipin_N	1	114	2.4e-52	PFAM
low complexity region	136	148	N/A	INTRINSIC
low complexity region	155	172	N/A	INTRINSIC
low complexity region	176	191	N/A	INTRINSIC
low complexity region	220	233	N/A	INTRINSIC
low complexity region	271	282	N/A	INTRINSIC
low complexity region	528	538	N/A	INTRINSIC
LNS2	606	762	1.4e-105	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000109455

SMART Domains

Protein: ENSMUSP00000105081
Gene: ENSMUSG00000027412

Domain	Start	End	E-Value	Type
Pfam:Lipin_N	1	114	2.4e-52	PFAM
low complexity region	136	148	N/A	INTRINSIC
low complexity region	155	172	N/A	INTRINSIC
low complexity region	176	191	N/A	INTRINSIC
low complexity region	220	233	N/A	INTRINSIC
low complexity region	271	282	N/A	INTRINSIC
low complexity region	528	538	N/A	INTRINSIC
LNS2	606	762	1.4e-105	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000109456

SMART Domains

Protein: ENSMUSP00000105082
Gene: ENSMUSG00000027412

Domain	Start	End	E-Value	Type
Pfam:Lipin_N	1	114	5.8e-52	PFAM
low complexity region	136	148	N/A	INTRINSIC
low complexity region	155	172	N/A	INTRINSIC
low complexity region	176	191	N/A	INTRINSIC
low complexity region	220	233	N/A	INTRINSIC
low complexity region	271	282	N/A	INTRINSIC
low complexity region	559	569	N/A	INTRINSIC
LNS2	637	793	1.4e-105	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000109456

SMART Domains

Protein: ENSMUSP00000105082
Gene: ENSMUSG00000027412

Domain	Start	End	E-Value	Type
Pfam:Lipin_N	1	114	5.8e-52	PFAM
low complexity region	136	148	N/A	INTRINSIC
low complexity region	155	172	N/A	INTRINSIC
low complexity region	176	191	N/A	INTRINSIC
low complexity region	220	233	N/A	INTRINSIC
low complexity region	271	282	N/A	INTRINSIC
low complexity region	559	569	N/A	INTRINSIC
LNS2	637	793	1.4e-105	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000109457

SMART Domains

Protein: ENSMUSP00000105083
Gene: ENSMUSG00000027412

Domain	Start	End	E-Value	Type
Pfam:Lipin_N	1	110	4.1e-48	PFAM
low complexity region	136	148	N/A	INTRINSIC
low complexity region	155	172	N/A	INTRINSIC
low complexity region	176	191	N/A	INTRINSIC
low complexity region	220	233	N/A	INTRINSIC
low complexity region	271	282	N/A	INTRINSIC
Pfam:Lipin_mid	435	538	9.5e-35	PFAM
low complexity region	569	579	N/A	INTRINSIC
LNS2	647	803	1.4e-105	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000109457

SMART Domains

Protein: ENSMUSP00000105083
Gene: ENSMUSG00000027412

Domain	Start	End	E-Value	Type
Pfam:Lipin_N	1	110	4.1e-48	PFAM
low complexity region	136	148	N/A	INTRINSIC
low complexity region	155	172	N/A	INTRINSIC
low complexity region	176	191	N/A	INTRINSIC
low complexity region	220	233	N/A	INTRINSIC
low complexity region	271	282	N/A	INTRINSIC
Pfam:Lipin_mid	435	538	9.5e-35	PFAM
low complexity region	569	579	N/A	INTRINSIC
LNS2	647	803	1.4e-105	SMART

Meta Mutation Damage Score

0.9756

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

98% (47/48)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the lipin family of proteins, and all family members share strong homology in their C-terminal region. This protein is thought to form hetero-oligomers with other lipin family members, while one family member, lipin 1, can also form homo-oligomers. This protein contains conserved motifs for phosphatidate phosphatase 1 (PAP1) activity as well as a domain that interacts with a transcriptional co-activator. Lipin complexes act in the cytoplasm to catalyze the dephosphorylation of phosphatidic acid to produce diacylglycerol, which is the precursor of both triglycerides and phospholipids. Lipin complexes are also thought to regulate gene expression as transcriptional co-activators in the nucleus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	T	C	11: 23,566,191	T709A	probably benign	Het
Abca6	T	C	11: 110,180,258	K1536E	possibly damaging	Het
Abhd16a	T	A	17: 35,101,960		probably null	Het
Actrt3	C	T	3: 30,598,547	A133T	probably benign	Het
Adcy10	C	T	1: 165,564,237	R1329W	probably damaging	Het
Apol7b	T	C	15: 77,423,456	M280V	possibly damaging	Het
Canx	A	T	11: 50,311,628	D50E	probably benign	Het
Csmd1	A	T	8: 16,288,682	D470E	probably damaging	Het
Cyp2c23	C	T	19: 44,014,930	D269N	probably damaging	Het
Ddah1	T	C	3: 145,759,019	V53A	probably benign	Het
Epha7	C	T	4: 28,871,937	S422L	probably benign	Het
Fastkd5	A	G	2: 130,615,041	V543A	possibly damaging	Het
Fggy	G	A	4: 95,769,506	G295R	probably damaging	Het
Frs2	T	C	10: 117,074,063	T465A	probably benign	Het
Glipr1	A	T	10: 111,988,832	N156K	probably benign	Het
Gnpnat1	C	T	14: 45,384,617	V40I	probably benign	Het
H2-Q7	T	C	17: 35,439,963	L130P	probably damaging	Het
Herc1	T	A	9: 66,451,383	L86*	probably null	Het
Hspg2	T	C	4: 137,548,368	L2778P	probably damaging	Het
Hspg2	T	A	4: 137,557,192	I3487N	possibly damaging	Het
Htra4	T	G	8: 25,025,700	I441L	probably benign	Het
Ints7	A	T	1: 191,596,224	H203L	probably damaging	Het
Lama2	T	C	10: 27,266,680	T601A	possibly damaging	Het
Lin7b	T	C	7: 45,368,432		probably benign	Het
Lmbr1l	G	A	15: 98,908,691	Q280*	probably null	Het
Map1lc3b	A	T	8: 121,593,529	H27L	possibly damaging	Het
Mfsd14a	C	A	3: 116,633,883	V369F	probably damaging	Het
Ndufa12	C	T	10: 94,220,779	A123V	probably benign	Het
Nek9	A	G	12: 85,303,514	F929L	probably benign	Het
Nup210	A	T	6: 91,076,697	D279E	probably benign	Het
Olfr553	A	G	7: 102,614,938	V17A	probably benign	Het
Parp1	T	C	1: 180,600,212		probably null	Het
Phc3	T	C	3: 30,907,452	I944V	probably damaging	Het
Phf20	C	T	2: 156,302,851	A793V	probably benign	Het
Phf21a	A	C	2: 92,357,007	R540S	probably benign	Het
Pogk	A	G	1: 166,401,911	C124R	probably benign	Het
Rif1	C	T	2: 52,076,175	S93L	probably damaging	Het
Sele	A	G	1: 164,049,515	E120G	probably damaging	Het
Slc4a1ap	T	C	5: 31,546,195	L49P		Het
Snap47	T	C	11: 59,428,547	D255G	probably damaging	Het
Tcstv3	T	C	13: 120,317,610	V15A	probably damaging	Het
Tmcc1	A	T	6: 116,043,131	Y453*	probably null	Het
Tpsg1	G	T	17: 25,373,210	G86V	probably damaging	Het
Urb1	CACTTAC	CAC	16: 90,772,573		probably benign	Het
Usp20	T	A	2: 31,011,474	V459E	probably damaging	Het
Vmn1r202	A	T	13: 22,501,620	L209Q	probably damaging	Het
Vps13b	T	C	15: 35,576,439	S998P	probably damaging	Het

Other mutations in Lpin3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00742:Lpin3	APN	2	160893998	missense	probably damaging	1.00
IGL01373:Lpin3	APN	2	160903729	missense	probably damaging	1.00
IGL01576:Lpin3	APN	2	160897127	missense	probably benign	0.02
IGL02124:Lpin3	APN	2	160895833	critical splice donor site	probably null
IGL02272:Lpin3	APN	2	160901661	missense	probably benign	0.15
IGL02314:Lpin3	APN	2	160898718	nonsense	probably null
IGL02374:Lpin3	APN	2	160895838	splice site	probably benign
IGL02554:Lpin3	APN	2	160896787	missense	probably damaging	1.00
IGL02693:Lpin3	APN	2	160905055	missense	probably damaging	1.00
IGL02858:Lpin3	APN	2	160898620	splice site	probably benign
IGL03143:Lpin3	APN	2	160903598	splice site	probably benign
R0100:Lpin3	UTSW	2	160905340	missense	probably damaging	1.00
R0100:Lpin3	UTSW	2	160905340	missense	probably damaging	1.00
R0211:Lpin3	UTSW	2	160898681	missense	probably damaging	1.00
R0211:Lpin3	UTSW	2	160898681	missense	probably damaging	1.00
R0329:Lpin3	UTSW	2	160905305	missense	probably benign
R0330:Lpin3	UTSW	2	160905305	missense	probably benign
R0570:Lpin3	UTSW	2	160904024	splice site	probably benign
R0633:Lpin3	UTSW	2	160903974	missense	probably damaging	0.99
R0781:Lpin3	UTSW	2	160894079	missense	probably benign	0.03
R1109:Lpin3	UTSW	2	160899021	missense	probably damaging	1.00
R1110:Lpin3	UTSW	2	160894079	missense	probably benign	0.03
R1404:Lpin3	UTSW	2	160892390	critical splice donor site	probably null
R1404:Lpin3	UTSW	2	160892390	critical splice donor site	probably null
R1513:Lpin3	UTSW	2	160904548	missense	probably damaging	1.00
R1543:Lpin3	UTSW	2	160895390	missense	possibly damaging	0.69
R1785:Lpin3	UTSW	2	160896809	nonsense	probably null
R1786:Lpin3	UTSW	2	160896809	nonsense	probably null
R1896:Lpin3	UTSW	2	160905298	missense	probably damaging	1.00
R4440:Lpin3	UTSW	2	160898645	missense	probably benign
R4470:Lpin3	UTSW	2	160895434	missense	probably benign	0.00
R4996:Lpin3	UTSW	2	160905287	missense	probably damaging	1.00
R5014:Lpin3	UTSW	2	160904828	missense	probably damaging	1.00
R5124:Lpin3	UTSW	2	160897061	missense	probably benign
R5184:Lpin3	UTSW	2	160897138	missense	probably benign
R5405:Lpin3	UTSW	2	160903929	missense	probably damaging	1.00
R5442:Lpin3	UTSW	2	160905016	missense	probably damaging	1.00
R5666:Lpin3	UTSW	2	160897330	missense	probably benign
R5670:Lpin3	UTSW	2	160897330	missense	probably benign
R5693:Lpin3	UTSW	2	160895400	missense	probably benign	0.00
R6084:Lpin3	UTSW	2	160895801	missense	probably benign	0.38
R6994:Lpin3	UTSW	2	160904883	missense	probably damaging	1.00
R7090:Lpin3	UTSW	2	160896752	missense	probably damaging	0.96
R7157:Lpin3	UTSW	2	160898707	missense	probably benign	0.02
R7207:Lpin3	UTSW	2	160894003	nonsense	probably null
R7430:Lpin3	UTSW	2	160898666	missense	probably benign	0.06
R7459:Lpin3	UTSW	2	160897300	missense	probably benign	0.06
R7644:Lpin3	UTSW	2	160896770	missense	probably benign	0.02
R7706:Lpin3	UTSW	2	160905290	missense	probably damaging	1.00
R7803:Lpin3	UTSW	2	160895390	missense	possibly damaging	0.69
R8443:Lpin3	UTSW	2	160895353	missense	probably damaging	1.00
R8985:Lpin3	UTSW	2	160896754	missense	probably benign	0.00
R9288:Lpin3	UTSW	2	160903632	missense	probably damaging	1.00
R9385:Lpin3	UTSW	2	160897073	missense	probably benign
X0002:Lpin3	UTSW	2	160903717	missense	probably damaging	1.00
Z1088:Lpin3	UTSW	2	160892231	missense	probably damaging	0.99
Z1176:Lpin3	UTSW	2	160899785	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTACTGTCAAAGTGTAGGGCAG -3'
(R):5'- AGAATGTGGCCCAGAGCATC -3'

Sequencing Primer
(F):5'- GGCAGTAGGGCATTATACCTTCC -3'
(R):5'- GAGCATCCGACCTATAGCCAGAG -3'

Posted On

2020-03-09