Incidental Mutation 'R7603:Lpin3'
ID 628336
Institutional Source Beutler Lab
Gene Symbol Lpin3
Ensembl Gene ENSMUSG00000027412
Gene Name lipin 3
Synonyms 9130206L11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7603 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 160880670-160906002 bp(+) (GRCm38)
Type of Mutation splice site (3 bp from exon)
DNA Base Change (assembly) G to T at 160903754 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000105083 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040872] [ENSMUST00000040872] [ENSMUST00000057169] [ENSMUST00000109454] [ENSMUST00000109455] [ENSMUST00000109455] [ENSMUST00000109456] [ENSMUST00000109456] [ENSMUST00000109457] [ENSMUST00000109457]
AlphaFold Q99PI4
Predicted Effect probably null
Transcript: ENSMUST00000040872
SMART Domains Protein: ENSMUSP00000043053
Gene: ENSMUSG00000027412

DomainStartEndE-ValueType
Pfam:Lipin_N 1 114 5.8e-52 PFAM
low complexity region 136 148 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
low complexity region 220 233 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
low complexity region 559 569 N/A INTRINSIC
LNS2 637 793 1.4e-105 SMART
Predicted Effect probably null
Transcript: ENSMUST00000040872
SMART Domains Protein: ENSMUSP00000043053
Gene: ENSMUSG00000027412

DomainStartEndE-ValueType
Pfam:Lipin_N 1 114 5.8e-52 PFAM
low complexity region 136 148 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
low complexity region 220 233 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
low complexity region 559 569 N/A INTRINSIC
LNS2 637 793 1.4e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000057169
SMART Domains Protein: ENSMUSP00000059732
Gene: ENSMUSG00000050700

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:EMI 55 125 7.3e-18 PFAM
low complexity region 144 161 N/A INTRINSIC
low complexity region 281 295 N/A INTRINSIC
low complexity region 359 381 N/A INTRINSIC
low complexity region 451 460 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109454
SMART Domains Protein: ENSMUSP00000105080
Gene: ENSMUSG00000050700

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:EMI 54 127 6.4e-22 PFAM
low complexity region 144 161 N/A INTRINSIC
low complexity region 234 248 N/A INTRINSIC
low complexity region 312 334 N/A INTRINSIC
low complexity region 404 413 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000109455
SMART Domains Protein: ENSMUSP00000105081
Gene: ENSMUSG00000027412

DomainStartEndE-ValueType
Pfam:Lipin_N 1 114 2.4e-52 PFAM
low complexity region 136 148 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
low complexity region 220 233 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
low complexity region 528 538 N/A INTRINSIC
LNS2 606 762 1.4e-105 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109455
SMART Domains Protein: ENSMUSP00000105081
Gene: ENSMUSG00000027412

DomainStartEndE-ValueType
Pfam:Lipin_N 1 114 2.4e-52 PFAM
low complexity region 136 148 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
low complexity region 220 233 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
low complexity region 528 538 N/A INTRINSIC
LNS2 606 762 1.4e-105 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109456
SMART Domains Protein: ENSMUSP00000105082
Gene: ENSMUSG00000027412

DomainStartEndE-ValueType
Pfam:Lipin_N 1 114 5.8e-52 PFAM
low complexity region 136 148 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
low complexity region 220 233 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
low complexity region 559 569 N/A INTRINSIC
LNS2 637 793 1.4e-105 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109456
SMART Domains Protein: ENSMUSP00000105082
Gene: ENSMUSG00000027412

DomainStartEndE-ValueType
Pfam:Lipin_N 1 114 5.8e-52 PFAM
low complexity region 136 148 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
low complexity region 220 233 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
low complexity region 559 569 N/A INTRINSIC
LNS2 637 793 1.4e-105 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109457
SMART Domains Protein: ENSMUSP00000105083
Gene: ENSMUSG00000027412

DomainStartEndE-ValueType
Pfam:Lipin_N 1 110 4.1e-48 PFAM
low complexity region 136 148 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
low complexity region 220 233 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
Pfam:Lipin_mid 435 538 9.5e-35 PFAM
low complexity region 569 579 N/A INTRINSIC
LNS2 647 803 1.4e-105 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109457
SMART Domains Protein: ENSMUSP00000105083
Gene: ENSMUSG00000027412

DomainStartEndE-ValueType
Pfam:Lipin_N 1 110 4.1e-48 PFAM
low complexity region 136 148 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
low complexity region 220 233 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
Pfam:Lipin_mid 435 538 9.5e-35 PFAM
low complexity region 569 579 N/A INTRINSIC
LNS2 647 803 1.4e-105 SMART
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the lipin family of proteins, and all family members share strong homology in their C-terminal region. This protein is thought to form hetero-oligomers with other lipin family members, while one family member, lipin 1, can also form homo-oligomers. This protein contains conserved motifs for phosphatidate phosphatase 1 (PAP1) activity as well as a domain that interacts with a transcriptional co-activator. Lipin complexes act in the cytoplasm to catalyze the dephosphorylation of phosphatidic acid to produce diacylglycerol, which is the precursor of both triglycerides and phospholipids. Lipin complexes are also thought to regulate gene expression as transcriptional co-activators in the nucleus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik T C 11: 23,566,191 T709A probably benign Het
Abca6 T C 11: 110,180,258 K1536E possibly damaging Het
Abhd16a T A 17: 35,101,960 probably null Het
Actrt3 C T 3: 30,598,547 A133T probably benign Het
Adcy10 C T 1: 165,564,237 R1329W probably damaging Het
Apol7b T C 15: 77,423,456 M280V possibly damaging Het
Canx A T 11: 50,311,628 D50E probably benign Het
Csmd1 A T 8: 16,288,682 D470E probably damaging Het
Cyp2c23 C T 19: 44,014,930 D269N probably damaging Het
Ddah1 T C 3: 145,759,019 V53A probably benign Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Fastkd5 A G 2: 130,615,041 V543A possibly damaging Het
Fggy G A 4: 95,769,506 G295R probably damaging Het
Frs2 T C 10: 117,074,063 T465A probably benign Het
Glipr1 A T 10: 111,988,832 N156K probably benign Het
Gnpnat1 C T 14: 45,384,617 V40I probably benign Het
H2-Q7 T C 17: 35,439,963 L130P probably damaging Het
Herc1 T A 9: 66,451,383 L86* probably null Het
Hspg2 T C 4: 137,548,368 L2778P probably damaging Het
Hspg2 T A 4: 137,557,192 I3487N possibly damaging Het
Htra4 T G 8: 25,025,700 I441L probably benign Het
Ints7 A T 1: 191,596,224 H203L probably damaging Het
Lama2 T C 10: 27,266,680 T601A possibly damaging Het
Lin7b T C 7: 45,368,432 probably benign Het
Lmbr1l G A 15: 98,908,691 Q280* probably null Het
Map1lc3b A T 8: 121,593,529 H27L possibly damaging Het
Mfsd14a C A 3: 116,633,883 V369F probably damaging Het
Ndufa12 C T 10: 94,220,779 A123V probably benign Het
Nek9 A G 12: 85,303,514 F929L probably benign Het
Nup210 A T 6: 91,076,697 D279E probably benign Het
Olfr553 A G 7: 102,614,938 V17A probably benign Het
Parp1 T C 1: 180,600,212 probably null Het
Phc3 T C 3: 30,907,452 I944V probably damaging Het
Phf20 C T 2: 156,302,851 A793V probably benign Het
Phf21a A C 2: 92,357,007 R540S probably benign Het
Pogk A G 1: 166,401,911 C124R probably benign Het
Rif1 C T 2: 52,076,175 S93L probably damaging Het
Sele A G 1: 164,049,515 E120G probably damaging Het
Slc4a1ap T C 5: 31,546,195 L49P Het
Snap47 T C 11: 59,428,547 D255G probably damaging Het
Tcstv3 T C 13: 120,317,610 V15A probably damaging Het
Tmcc1 A T 6: 116,043,131 Y453* probably null Het
Tpsg1 G T 17: 25,373,210 G86V probably damaging Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Usp20 T A 2: 31,011,474 V459E probably damaging Het
Vmn1r202 A T 13: 22,501,620 L209Q probably damaging Het
Vps13b T C 15: 35,576,439 S998P probably damaging Het
Other mutations in Lpin3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00742:Lpin3 APN 2 160893998 missense probably damaging 1.00
IGL01373:Lpin3 APN 2 160903729 missense probably damaging 1.00
IGL01576:Lpin3 APN 2 160897127 missense probably benign 0.02
IGL02124:Lpin3 APN 2 160895833 critical splice donor site probably null
IGL02272:Lpin3 APN 2 160901661 missense probably benign 0.15
IGL02314:Lpin3 APN 2 160898718 nonsense probably null
IGL02374:Lpin3 APN 2 160895838 splice site probably benign
IGL02554:Lpin3 APN 2 160896787 missense probably damaging 1.00
IGL02693:Lpin3 APN 2 160905055 missense probably damaging 1.00
IGL02858:Lpin3 APN 2 160898620 splice site probably benign
IGL03143:Lpin3 APN 2 160903598 splice site probably benign
R0100:Lpin3 UTSW 2 160905340 missense probably damaging 1.00
R0100:Lpin3 UTSW 2 160905340 missense probably damaging 1.00
R0211:Lpin3 UTSW 2 160898681 missense probably damaging 1.00
R0211:Lpin3 UTSW 2 160898681 missense probably damaging 1.00
R0329:Lpin3 UTSW 2 160905305 missense probably benign
R0330:Lpin3 UTSW 2 160905305 missense probably benign
R0570:Lpin3 UTSW 2 160904024 splice site probably benign
R0633:Lpin3 UTSW 2 160903974 missense probably damaging 0.99
R0781:Lpin3 UTSW 2 160894079 missense probably benign 0.03
R1109:Lpin3 UTSW 2 160899021 missense probably damaging 1.00
R1110:Lpin3 UTSW 2 160894079 missense probably benign 0.03
R1404:Lpin3 UTSW 2 160892390 critical splice donor site probably null
R1404:Lpin3 UTSW 2 160892390 critical splice donor site probably null
R1513:Lpin3 UTSW 2 160904548 missense probably damaging 1.00
R1543:Lpin3 UTSW 2 160895390 missense possibly damaging 0.69
R1785:Lpin3 UTSW 2 160896809 nonsense probably null
R1786:Lpin3 UTSW 2 160896809 nonsense probably null
R1896:Lpin3 UTSW 2 160905298 missense probably damaging 1.00
R4440:Lpin3 UTSW 2 160898645 missense probably benign
R4470:Lpin3 UTSW 2 160895434 missense probably benign 0.00
R4996:Lpin3 UTSW 2 160905287 missense probably damaging 1.00
R5014:Lpin3 UTSW 2 160904828 missense probably damaging 1.00
R5124:Lpin3 UTSW 2 160897061 missense probably benign
R5184:Lpin3 UTSW 2 160897138 missense probably benign
R5405:Lpin3 UTSW 2 160903929 missense probably damaging 1.00
R5442:Lpin3 UTSW 2 160905016 missense probably damaging 1.00
R5666:Lpin3 UTSW 2 160897330 missense probably benign
R5670:Lpin3 UTSW 2 160897330 missense probably benign
R5693:Lpin3 UTSW 2 160895400 missense probably benign 0.00
R6084:Lpin3 UTSW 2 160895801 missense probably benign 0.38
R6994:Lpin3 UTSW 2 160904883 missense probably damaging 1.00
R7090:Lpin3 UTSW 2 160896752 missense probably damaging 0.96
R7157:Lpin3 UTSW 2 160898707 missense probably benign 0.02
R7207:Lpin3 UTSW 2 160894003 nonsense probably null
R7430:Lpin3 UTSW 2 160898666 missense probably benign 0.06
R7459:Lpin3 UTSW 2 160897300 missense probably benign 0.06
R7644:Lpin3 UTSW 2 160896770 missense probably benign 0.02
R7706:Lpin3 UTSW 2 160905290 missense probably damaging 1.00
R7803:Lpin3 UTSW 2 160895390 missense possibly damaging 0.69
R8443:Lpin3 UTSW 2 160895353 missense probably damaging 1.00
R8985:Lpin3 UTSW 2 160896754 missense probably benign 0.00
R9288:Lpin3 UTSW 2 160903632 missense probably damaging 1.00
R9385:Lpin3 UTSW 2 160897073 missense probably benign
X0002:Lpin3 UTSW 2 160903717 missense probably damaging 1.00
Z1088:Lpin3 UTSW 2 160892231 missense probably damaging 0.99
Z1176:Lpin3 UTSW 2 160899785 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTACTGTCAAAGTGTAGGGCAG -3'
(R):5'- AGAATGTGGCCCAGAGCATC -3'

Sequencing Primer
(F):5'- GGCAGTAGGGCATTATACCTTCC -3'
(R):5'- GAGCATCCGACCTATAGCCAGAG -3'
Posted On 2020-03-09