Incidental Mutation 'R7603:Lin7b'
ID 628338
Institutional Source Beutler Lab
Gene Symbol Lin7b
Ensembl Gene ENSMUSG00000003872
Gene Name lin-7 homolog B (C. elegans)
Synonyms LIN-7B, Veli2, MALS-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.429) question?
Stock # R7603 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 45367891-45370583 bp(-) (GRCm38)
Type of Mutation unclassified
DNA Base Change (assembly) T to C at 45368432 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148200 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003961] [ENSMUST00000003971] [ENSMUST00000210865] [ENSMUST00000211067]
AlphaFold O88951
Predicted Effect probably benign
Transcript: ENSMUST00000003961
SMART Domains Protein: ENSMUSP00000003961
Gene: ENSMUSG00000003863

DomainStartEndE-ValueType
coiled coil region 27 129 N/A INTRINSIC
coiled coil region 167 426 N/A INTRINSIC
coiled coil region 448 500 N/A INTRINSIC
low complexity region 534 550 N/A INTRINSIC
coiled coil region 597 642 N/A INTRINSIC
low complexity region 651 672 N/A INTRINSIC
low complexity region 707 719 N/A INTRINSIC
SAM 835 904 1.46e-10 SMART
SAM 950 1017 8.22e-5 SMART
SAM 1038 1110 3.58e-5 SMART
low complexity region 1156 1169 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000003971
SMART Domains Protein: ENSMUSP00000003971
Gene: ENSMUSG00000003872

DomainStartEndE-ValueType
L27 13 68 1.96e-12 SMART
low complexity region 71 84 N/A INTRINSIC
PDZ 101 175 6.16e-24 SMART
Predicted Effect unknown
Transcript: ENSMUST00000210865
AA Change: N51S
Predicted Effect probably benign
Transcript: ENSMUST00000211067
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (47/48)
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik T C 11: 23,566,191 T709A probably benign Het
Abca6 T C 11: 110,180,258 K1536E possibly damaging Het
Abhd16a T A 17: 35,101,960 probably null Het
Actrt3 C T 3: 30,598,547 A133T probably benign Het
Adcy10 C T 1: 165,564,237 R1329W probably damaging Het
Apol7b T C 15: 77,423,456 M280V possibly damaging Het
Canx A T 11: 50,311,628 D50E probably benign Het
Csmd1 A T 8: 16,288,682 D470E probably damaging Het
Cyp2c23 C T 19: 44,014,930 D269N probably damaging Het
Ddah1 T C 3: 145,759,019 V53A probably benign Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Fastkd5 A G 2: 130,615,041 V543A possibly damaging Het
Fggy G A 4: 95,769,506 G295R probably damaging Het
Frs2 T C 10: 117,074,063 T465A probably benign Het
Glipr1 A T 10: 111,988,832 N156K probably benign Het
Gnpnat1 C T 14: 45,384,617 V40I probably benign Het
H2-Q7 T C 17: 35,439,963 L130P probably damaging Het
Herc1 T A 9: 66,451,383 L86* probably null Het
Hspg2 T C 4: 137,548,368 L2778P probably damaging Het
Hspg2 T A 4: 137,557,192 I3487N possibly damaging Het
Htra4 T G 8: 25,025,700 I441L probably benign Het
Ints7 A T 1: 191,596,224 H203L probably damaging Het
Lama2 T C 10: 27,266,680 T601A possibly damaging Het
Lmbr1l G A 15: 98,908,691 Q280* probably null Het
Lpin3 G T 2: 160,903,754 probably null Het
Map1lc3b A T 8: 121,593,529 H27L possibly damaging Het
Mfsd14a C A 3: 116,633,883 V369F probably damaging Het
Ndufa12 C T 10: 94,220,779 A123V probably benign Het
Nek9 A G 12: 85,303,514 F929L probably benign Het
Nup210 A T 6: 91,076,697 D279E probably benign Het
Olfr553 A G 7: 102,614,938 V17A probably benign Het
Parp1 T C 1: 180,600,212 probably null Het
Phc3 T C 3: 30,907,452 I944V probably damaging Het
Phf20 C T 2: 156,302,851 A793V probably benign Het
Phf21a A C 2: 92,357,007 R540S probably benign Het
Pogk A G 1: 166,401,911 C124R probably benign Het
Rif1 C T 2: 52,076,175 S93L probably damaging Het
Sele A G 1: 164,049,515 E120G probably damaging Het
Slc4a1ap T C 5: 31,546,195 L49P Het
Snap47 T C 11: 59,428,547 D255G probably damaging Het
Tcstv3 T C 13: 120,317,610 V15A probably damaging Het
Tmcc1 A T 6: 116,043,131 Y453* probably null Het
Tpsg1 G T 17: 25,373,210 G86V probably damaging Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Usp20 T A 2: 31,011,474 V459E probably damaging Het
Vmn1r202 A T 13: 22,501,620 L209Q probably damaging Het
Vps13b T C 15: 35,576,439 S998P probably damaging Het
Other mutations in Lin7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01448:Lin7b APN 7 45369200 missense probably damaging 1.00
R0539:Lin7b UTSW 7 45369902 unclassified probably benign
R1730:Lin7b UTSW 7 45369927 missense probably benign
R1783:Lin7b UTSW 7 45369927 missense probably benign
R2330:Lin7b UTSW 7 45369913 critical splice donor site probably null
R2920:Lin7b UTSW 7 45368397 missense possibly damaging 0.48
R5646:Lin7b UTSW 7 45369193 missense probably damaging 0.96
R7155:Lin7b UTSW 7 45370227 missense probably damaging 0.99
R7487:Lin7b UTSW 7 45369940 missense possibly damaging 0.81
R7576:Lin7b UTSW 7 45369225 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAATGTTGAAGGCCGCTGTG -3'
(R):5'- TGTGCCTAAAGTTGGTGATCCAC -3'

Sequencing Primer
(F):5'- CACTGGCCTGATTTGGGTATCTAAG -3'
(R):5'- TGCCTAAAGTTGGTGATCCACTAGAG -3'
Posted On 2020-03-09