Incidental Mutation 'R7603:Abhd16a'
ID628340
Institutional Source Beutler Lab
Gene Symbol Abhd16a
Ensembl Gene ENSMUSG00000007036
Gene Nameabhydrolase domain containing 16A
SynonymsD17H6S82E, Bat5, NG26
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.471) question?
Stock #R7603 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location35089263-35102987 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 35101960 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000007251 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007251] [ENSMUST00000173846]
Predicted Effect probably null
Transcript: ENSMUST00000007251
SMART Domains Protein: ENSMUSP00000007251
Gene: ENSMUSG00000007036

DomainStartEndE-ValueType
low complexity region 28 43 N/A INTRINSIC
transmembrane domain 60 82 N/A INTRINSIC
transmembrane domain 95 117 N/A INTRINSIC
low complexity region 165 179 N/A INTRINSIC
Pfam:Abhydrolase_1 280 415 6.3e-10 PFAM
Pfam:Abhydrolase_5 282 465 4.7e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173846
SMART Domains Protein: ENSMUSP00000133505
Gene: ENSMUSG00000007036

DomainStartEndE-ValueType
low complexity region 28 43 N/A INTRINSIC
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] A cluster of genes, BAT1-BAT5, has been localized in the vicinity of the genes for tumor necrosis factor alpha and tumor necrosis factor beta. These genes are all within the human major histocompatibility complex class III region. The protein encoded by this gene is thought to be involved in some aspects of immunity. Alternatively spliced transcript variants have been described. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial prenatal lethality, decreased body size and weight, and decreased brain lysophosphatidylserines. Macrophages display a reduction in lysophosphatidylserines and LPS-induced cytokine production. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik T C 11: 23,566,191 T709A probably benign Het
Abca6 T C 11: 110,180,258 K1536E possibly damaging Het
Actrt3 C T 3: 30,598,547 A133T probably benign Het
Adcy10 C T 1: 165,564,237 R1329W probably damaging Het
Apol7b T C 15: 77,423,456 M280V possibly damaging Het
Canx A T 11: 50,311,628 D50E probably benign Het
Csmd1 A T 8: 16,288,682 D470E probably damaging Het
Cyp2c23 C T 19: 44,014,930 D269N probably damaging Het
Ddah1 T C 3: 145,759,019 V53A probably benign Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Fastkd5 A G 2: 130,615,041 V543A possibly damaging Het
Fggy G A 4: 95,769,506 G295R probably damaging Het
Frs2 T C 10: 117,074,063 T465A probably benign Het
Glipr1 A T 10: 111,988,832 N156K probably benign Het
Gnpnat1 C T 14: 45,384,617 V40I probably benign Het
H2-Q7 T C 17: 35,439,963 L130P probably damaging Het
Herc1 T A 9: 66,451,383 L86* probably null Het
Hspg2 T C 4: 137,548,368 L2778P probably damaging Het
Hspg2 T A 4: 137,557,192 I3487N possibly damaging Het
Htra4 T G 8: 25,025,700 I441L probably benign Het
Ints7 A T 1: 191,596,224 H203L probably damaging Het
Lama2 T C 10: 27,266,680 T601A possibly damaging Het
Lin7b T C 7: 45,368,432 probably benign Het
Lmbr1l G A 15: 98,908,691 Q280* probably null Het
Lpin3 G T 2: 160,903,754 probably null Het
Map1lc3b A T 8: 121,593,529 H27L possibly damaging Het
Mfsd14a C A 3: 116,633,883 V369F probably damaging Het
Ndufa12 C T 10: 94,220,779 A123V probably benign Het
Nek9 A G 12: 85,303,514 F929L probably benign Het
Nup210 A T 6: 91,076,697 D279E probably benign Het
Olfr553 A G 7: 102,614,938 V17A probably benign Het
Parp1 T C 1: 180,600,212 probably null Het
Phc3 T C 3: 30,907,452 I944V probably damaging Het
Phf20 C T 2: 156,302,851 A793V probably benign Het
Phf21a A C 2: 92,357,007 R540S probably benign Het
Pogk A G 1: 166,401,911 C124R probably benign Het
Rif1 C T 2: 52,076,175 S93L probably damaging Het
Sele A G 1: 164,049,515 E120G probably damaging Het
Slc4a1ap T C 5: 31,546,195 L49P Het
Snap47 T C 11: 59,428,547 D255G probably damaging Het
Tcstv3 T C 13: 120,317,610 V15A probably damaging Het
Tmcc1 A T 6: 116,043,131 Y453* probably null Het
Tpsg1 G T 17: 25,373,210 G86V probably damaging Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Usp20 T A 2: 31,011,474 V459E probably damaging Het
Vmn1r202 A T 13: 22,501,620 L209Q probably damaging Het
Vps13b T C 15: 35,576,439 S998P probably damaging Het
Other mutations in Abhd16a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01543:Abhd16a APN 17 35091037 missense probably damaging 0.96
IGL01943:Abhd16a APN 17 35096483 missense probably benign 0.00
IGL01955:Abhd16a APN 17 35101340 missense probably damaging 1.00
IGL02563:Abhd16a APN 17 35101245 missense probably damaging 1.00
deprived UTSW 17 35098809 critical splice donor site probably null
downtrodden UTSW 17 35101851 missense probably benign 0.12
R0765:Abhd16a UTSW 17 35101851 missense probably benign 0.12
R1931:Abhd16a UTSW 17 35101015 missense probably benign 0.00
R3788:Abhd16a UTSW 17 35101587 missense probably damaging 0.99
R3789:Abhd16a UTSW 17 35101587 missense probably damaging 0.99
R4567:Abhd16a UTSW 17 35096523 missense probably damaging 1.00
R4587:Abhd16a UTSW 17 35101087 critical splice donor site probably null
R4701:Abhd16a UTSW 17 35096606 critical splice donor site probably null
R4736:Abhd16a UTSW 17 35101883 missense probably benign 0.01
R4959:Abhd16a UTSW 17 35102342 missense probably benign 0.26
R4973:Abhd16a UTSW 17 35102342 missense probably benign 0.26
R5338:Abhd16a UTSW 17 35094302 missense probably damaging 1.00
R5896:Abhd16a UTSW 17 35091725 intron probably benign
R6092:Abhd16a UTSW 17 35098810 critical splice donor site probably null
R6533:Abhd16a UTSW 17 35098809 critical splice donor site probably null
R6881:Abhd16a UTSW 17 35096601 missense probably benign 0.00
R7972:Abhd16a UTSW 17 35101311 missense probably damaging 0.99
R8466:Abhd16a UTSW 17 35094260 missense probably damaging 1.00
R8721:Abhd16a UTSW 17 35091595 missense possibly damaging 0.95
Z1177:Abhd16a UTSW 17 35099001 critical splice donor site probably null
Z1177:Abhd16a UTSW 17 35102475 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGCCCGTGCCCTTAAATC -3'
(R):5'- ACCTTCCTCTAGCTGGGAAG -3'

Sequencing Primer
(F):5'- ACTCCTGCCTCAGCTGTGG -3'
(R):5'- TCTAGCTGGGAAGAGGCCTC -3'
Posted On2020-03-09