Incidental Mutation 'R7665:Rbbp6'
ID 628350
Institutional Source Beutler Lab
Gene Symbol Rbbp6
Ensembl Gene ENSMUSG00000030779
Gene Name retinoblastoma binding protein 6, ubiquitin ligase
Synonyms C030034J04Rik, 4933422O15Rik
MMRRC Submission 045739-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7665 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 122568980-122601780 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to A at 122589255 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000155989 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052135] [ENSMUST00000071590] [ENSMUST00000231323]
AlphaFold P97868
Predicted Effect probably null
Transcript: ENSMUST00000052135
SMART Domains Protein: ENSMUSP00000049528
Gene: ENSMUSG00000030779

DomainStartEndE-ValueType
DWNN 4 76 3.92e-42 SMART
low complexity region 101 110 N/A INTRINSIC
ZnF_C2HC 161 177 5.67e-5 SMART
low complexity region 233 259 N/A INTRINSIC
RING 260 300 6.05e-4 SMART
low complexity region 338 349 N/A INTRINSIC
low complexity region 376 390 N/A INTRINSIC
low complexity region 474 485 N/A INTRINSIC
low complexity region 551 610 N/A INTRINSIC
coiled coil region 653 679 N/A INTRINSIC
low complexity region 680 774 N/A INTRINSIC
low complexity region 824 844 N/A INTRINSIC
low complexity region 929 943 N/A INTRINSIC
low complexity region 1003 1025 N/A INTRINSIC
internal_repeat_2 1026 1091 4.38e-6 PROSPERO
internal_repeat_1 1038 1107 3.76e-7 PROSPERO
low complexity region 1120 1141 N/A INTRINSIC
low complexity region 1143 1154 N/A INTRINSIC
low complexity region 1247 1258 N/A INTRINSIC
internal_repeat_2 1395 1466 4.38e-6 PROSPERO
low complexity region 1472 1490 N/A INTRINSIC
internal_repeat_1 1523 1586 3.76e-7 PROSPERO
low complexity region 1689 1752 N/A INTRINSIC
low complexity region 1758 1784 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000071590
SMART Domains Protein: ENSMUSP00000071519
Gene: ENSMUSG00000030779

DomainStartEndE-ValueType
DWNN 4 76 3.92e-42 SMART
low complexity region 101 110 N/A INTRINSIC
ZnF_C2HC 161 177 5.67e-5 SMART
low complexity region 233 259 N/A INTRINSIC
RING 260 300 6.05e-4 SMART
low complexity region 338 349 N/A INTRINSIC
low complexity region 376 390 N/A INTRINSIC
low complexity region 474 485 N/A INTRINSIC
low complexity region 551 610 N/A INTRINSIC
low complexity region 653 740 N/A INTRINSIC
low complexity region 790 810 N/A INTRINSIC
low complexity region 895 909 N/A INTRINSIC
low complexity region 969 991 N/A INTRINSIC
internal_repeat_2 992 1057 5.65e-6 PROSPERO
internal_repeat_1 1004 1073 5.01e-7 PROSPERO
low complexity region 1086 1107 N/A INTRINSIC
low complexity region 1109 1120 N/A INTRINSIC
low complexity region 1213 1224 N/A INTRINSIC
internal_repeat_2 1361 1432 5.65e-6 PROSPERO
low complexity region 1438 1456 N/A INTRINSIC
internal_repeat_1 1489 1552 5.01e-7 PROSPERO
low complexity region 1655 1718 N/A INTRINSIC
low complexity region 1724 1750 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000231323
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The retinoblastoma tumor suppressor (pRB) protein binds with many other proteins. In various human cancers, pRB suppresses cellular proliferation and is inactivated. Cell cycle-dependent phosphorylation regulates the activity of pRB. This gene encodes a protein which binds to underphosphorylated but not phosphorylated pRB. Multiple alternatively spliced transcript variants that encode different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality, reduced size, growth retardation and increased apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930519G04Rik A G 5: 115,012,384 (GRCm39) probably null Het
A830018L16Rik T C 1: 12,042,323 (GRCm39) S448P probably damaging Het
Abca4 C T 3: 121,838,139 (GRCm39) probably benign Het
Ackr2 A G 9: 121,738,374 (GRCm39) M250V probably benign Het
Actn4 A G 7: 28,615,632 (GRCm39) I147T probably damaging Het
Adgrv1 C T 13: 81,647,261 (GRCm39) S3093N probably damaging Het
Arid5b C T 10: 67,934,417 (GRCm39) G495E probably benign Het
Armh1 C A 4: 117,070,938 (GRCm39) A396S probably benign Het
Brwd1 G A 16: 95,842,543 (GRCm39) T798M probably benign Het
Cdk13 G A 13: 17,947,138 (GRCm39) T540I possibly damaging Het
Cdkn1c A G 7: 143,014,371 (GRCm39) V25A possibly damaging Het
Col2a1 T C 15: 97,874,581 (GRCm39) E1420G unknown Het
Dbf4 G A 5: 8,447,867 (GRCm39) P448S probably damaging Het
Dnajb7 T C 15: 81,291,620 (GRCm39) N239S probably benign Het
Dnttip1 A G 2: 164,596,061 (GRCm39) D102G probably damaging Het
Dpp8 T A 9: 64,986,000 (GRCm39) V830D probably damaging Het
Eddm13 G A 7: 6,272,891 (GRCm39) probably null Het
Eef1g T C 19: 8,945,653 (GRCm39) V29A probably benign Het
Enpp2 T A 15: 54,702,790 (GRCm39) Y906F probably damaging Het
Epb41l4a A G 18: 34,139,069 (GRCm39) L23P possibly damaging Het
Exoc1 T A 5: 76,691,420 (GRCm39) M248K probably benign Het
Fam83b T C 9: 76,398,157 (GRCm39) Y982C probably damaging Het
Fat4 C T 3: 38,943,327 (GRCm39) A740V probably benign Het
Fsip2 T A 2: 82,812,149 (GRCm39) S2823T probably benign Het
Gckr T C 5: 31,454,899 (GRCm39) Het
Gpr150 A T 13: 76,204,093 (GRCm39) V284E probably damaging Het
Grtp1 T G 8: 13,227,103 (GRCm39) I344L probably benign Het
Heatr5a T A 12: 52,008,313 (GRCm39) N10I probably damaging Het
Herc2 C A 7: 55,802,903 (GRCm39) L2109I probably damaging Het
Hs1bp3 T A 12: 8,367,935 (GRCm39) D61E probably damaging Het
Ifit1bl1 T A 19: 34,572,283 (GRCm39) Y58F probably benign Het
Itfg1 A G 8: 86,490,979 (GRCm39) F317L probably benign Het
Itsn1 T C 16: 91,638,491 (GRCm39) I764T unknown Het
Med8 A C 4: 118,268,853 (GRCm39) probably null Het
Mpeg1 C A 19: 12,440,458 (GRCm39) P639T probably damaging Het
Mtcl3 T A 10: 29,072,393 (GRCm39) Y562N probably damaging Het
Nedd9 A G 13: 41,469,785 (GRCm39) L456P probably benign Het
Neo1 A G 9: 58,833,078 (GRCm39) S556P probably damaging Het
Nphp3 T A 9: 103,882,592 (GRCm39) probably null Het
Nup205 T C 6: 35,154,555 (GRCm39) V53A possibly damaging Het
Nvl A T 1: 180,962,509 (GRCm39) S154T probably benign Het
Or10h1 G T 17: 33,418,603 (GRCm39) G194* probably null Het
Or1e31 A T 11: 73,689,787 (GRCm39) N265K probably benign Het
Or2ag2 A T 7: 106,485,880 (GRCm39) V48D possibly damaging Het
Or2h2c A G 17: 37,422,283 (GRCm39) M197T probably benign Het
Or51ah3 A T 7: 103,210,523 (GRCm39) I280F probably benign Het
Or9k7 T A 10: 130,047,130 (GRCm39) probably null Het
Parvg T C 15: 84,222,002 (GRCm39) I243T probably damaging Het
Paxip1 T A 5: 27,970,736 (GRCm39) M538L unknown Het
Pgghg G T 7: 140,525,382 (GRCm39) D428Y probably damaging Het
Pik3cd C T 4: 149,738,507 (GRCm39) V777M possibly damaging Het
Plcl2 A C 17: 50,914,185 (GRCm39) K398T probably benign Het
Plxna1 A T 6: 89,301,520 (GRCm39) probably null Het
Scin T A 12: 40,119,414 (GRCm39) N538I probably damaging Het
Sdcbp A G 4: 6,385,144 (GRCm39) D121G probably benign Het
Sgk1 T C 10: 21,872,561 (GRCm39) I311T probably damaging Het
Shq1 A C 6: 100,550,717 (GRCm39) L407W probably damaging Het
Sipa1 A T 19: 5,701,699 (GRCm39) S979T probably benign Het
Slc25a37 G T 14: 69,487,028 (GRCm39) T85K probably benign Het
Spag9 A T 11: 93,904,480 (GRCm39) Q112L probably damaging Het
Spg11 A T 2: 121,896,748 (GRCm39) V1686E probably damaging Het
Stap2 A G 17: 56,304,909 (GRCm39) V291A probably benign Het
Tnk2 C T 16: 32,499,344 (GRCm39) R886C probably damaging Het
Tnrc6c T A 11: 117,611,777 (GRCm39) D138E possibly damaging Het
Unc13c A G 9: 73,587,756 (GRCm39) S1426P probably benign Het
Vav1 G A 17: 57,604,086 (GRCm39) V163M probably damaging Het
Vmn2r67 T A 7: 84,801,196 (GRCm39) K247* probably null Het
Zc2hc1c T C 12: 85,343,336 (GRCm39) V491A possibly damaging Het
Zfp51 A G 17: 21,683,843 (GRCm39) T153A probably benign Het
Zyx A G 6: 42,333,096 (GRCm39) E374G probably damaging Het
Other mutations in Rbbp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Rbbp6 APN 7 122,587,908 (GRCm39) missense probably damaging 1.00
IGL00561:Rbbp6 APN 7 122,570,286 (GRCm39) missense probably damaging 1.00
IGL01144:Rbbp6 APN 7 122,575,169 (GRCm39) missense possibly damaging 0.95
IGL01325:Rbbp6 APN 7 122,587,841 (GRCm39) missense probably damaging 1.00
IGL01520:Rbbp6 APN 7 122,584,898 (GRCm39) missense possibly damaging 0.93
IGL01765:Rbbp6 APN 7 122,599,177 (GRCm39) unclassified probably benign
IGL01985:Rbbp6 APN 7 122,570,296 (GRCm39) missense probably damaging 1.00
IGL02094:Rbbp6 APN 7 122,596,485 (GRCm39) missense probably damaging 1.00
IGL02125:Rbbp6 APN 7 122,570,352 (GRCm39) critical splice donor site probably null
IGL02552:Rbbp6 APN 7 122,582,204 (GRCm39) missense probably damaging 0.98
IGL02805:Rbbp6 APN 7 122,600,411 (GRCm39) utr 3 prime probably benign
changeling UTSW 7 122,596,534 (GRCm39) splice site probably null
Puzzlewit UTSW 7 122,599,031 (GRCm39) unclassified probably benign
R0403:Rbbp6 UTSW 7 122,591,519 (GRCm39) missense probably damaging 0.99
R0855:Rbbp6 UTSW 7 122,591,471 (GRCm39) missense probably benign 0.22
R1132:Rbbp6 UTSW 7 122,599,336 (GRCm39) unclassified probably benign
R1463:Rbbp6 UTSW 7 122,591,676 (GRCm39) missense possibly damaging 0.89
R1867:Rbbp6 UTSW 7 122,596,252 (GRCm39) missense probably damaging 1.00
R1957:Rbbp6 UTSW 7 122,589,511 (GRCm39) missense probably benign 0.04
R1958:Rbbp6 UTSW 7 122,601,168 (GRCm39) unclassified probably benign
R1978:Rbbp6 UTSW 7 122,598,711 (GRCm39) unclassified probably benign
R1999:Rbbp6 UTSW 7 122,589,575 (GRCm39) missense probably damaging 0.98
R2164:Rbbp6 UTSW 7 122,598,697 (GRCm39) unclassified probably benign
R4181:Rbbp6 UTSW 7 122,593,958 (GRCm39) missense probably damaging 0.99
R4387:Rbbp6 UTSW 7 122,596,534 (GRCm39) splice site probably null
R4583:Rbbp6 UTSW 7 122,601,175 (GRCm39) unclassified probably benign
R4936:Rbbp6 UTSW 7 122,598,926 (GRCm39) unclassified probably benign
R4974:Rbbp6 UTSW 7 122,599,031 (GRCm39) unclassified probably benign
R4998:Rbbp6 UTSW 7 122,589,549 (GRCm39) missense probably benign 0.36
R5082:Rbbp6 UTSW 7 122,599,925 (GRCm39) utr 3 prime probably benign
R5502:Rbbp6 UTSW 7 122,587,947 (GRCm39) missense probably damaging 1.00
R5567:Rbbp6 UTSW 7 122,601,057 (GRCm39) utr 3 prime probably benign
R5570:Rbbp6 UTSW 7 122,601,057 (GRCm39) utr 3 prime probably benign
R5607:Rbbp6 UTSW 7 122,596,309 (GRCm39) missense probably damaging 1.00
R5608:Rbbp6 UTSW 7 122,596,309 (GRCm39) missense probably damaging 1.00
R5948:Rbbp6 UTSW 7 122,596,851 (GRCm39) missense probably damaging 1.00
R6134:Rbbp6 UTSW 7 122,596,534 (GRCm39) splice site probably null
R6172:Rbbp6 UTSW 7 122,597,778 (GRCm39) nonsense probably null
R6773:Rbbp6 UTSW 7 122,598,578 (GRCm39) unclassified probably benign
R6800:Rbbp6 UTSW 7 122,584,287 (GRCm39) missense possibly damaging 0.93
R7266:Rbbp6 UTSW 7 122,600,590 (GRCm39) missense unknown
R7298:Rbbp6 UTSW 7 122,600,417 (GRCm39) missense unknown
R7535:Rbbp6 UTSW 7 122,589,366 (GRCm39) missense probably benign 0.00
R7635:Rbbp6 UTSW 7 122,575,231 (GRCm39) missense possibly damaging 0.80
R7665:Rbbp6 UTSW 7 122,593,909 (GRCm39) missense possibly damaging 0.81
R7910:Rbbp6 UTSW 7 122,596,251 (GRCm39) missense possibly damaging 0.48
R7956:Rbbp6 UTSW 7 122,600,561 (GRCm39) missense unknown
R8043:Rbbp6 UTSW 7 122,584,468 (GRCm39) missense probably damaging 1.00
R8273:Rbbp6 UTSW 7 122,589,547 (GRCm39) missense probably benign 0.36
R8473:Rbbp6 UTSW 7 122,600,421 (GRCm39) utr 3 prime probably benign
R8679:Rbbp6 UTSW 7 122,600,516 (GRCm39) missense unknown
R8712:Rbbp6 UTSW 7 122,600,976 (GRCm39) missense unknown
R8802:Rbbp6 UTSW 7 122,587,680 (GRCm39) intron probably benign
R8911:Rbbp6 UTSW 7 122,591,268 (GRCm39) missense possibly damaging 0.53
R9152:Rbbp6 UTSW 7 122,600,697 (GRCm39) missense unknown
R9159:Rbbp6 UTSW 7 122,589,428 (GRCm39) missense probably damaging 0.99
R9308:Rbbp6 UTSW 7 122,596,221 (GRCm39) missense probably damaging 1.00
R9438:Rbbp6 UTSW 7 122,599,456 (GRCm39) missense
R9509:Rbbp6 UTSW 7 122,597,791 (GRCm39) missense unknown
R9608:Rbbp6 UTSW 7 122,591,268 (GRCm39) missense possibly damaging 0.53
R9636:Rbbp6 UTSW 7 122,601,175 (GRCm39) unclassified probably benign
R9707:Rbbp6 UTSW 7 122,589,061 (GRCm39) missense probably damaging 1.00
X0062:Rbbp6 UTSW 7 122,599,369 (GRCm39) unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GTGCCAGCTCGTGTTTAACATC -3'
(R):5'- ATCAGAGGATCCTGCTGTCTTG -3'

Sequencing Primer
(F):5'- CAGCACTCTTGGAGTCAGATG -3'
(R):5'- CTTGATATGGGAGATCTCATCAGAG -3'
Posted On 2020-03-11