Incidental Mutation 'R7762:Or4b1b'
ID 628366
Institutional Source Beutler Lab
Gene Symbol Or4b1b
Ensembl Gene ENSMUSG00000075061
Gene Name olfactory receptor family 4 subfamily B member 1B
Synonyms Olfr1272, GA_x6K02T2Q125-51636504-51635578, MOR227-3
MMRRC Submission 045818-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.117) question?
Stock # R7762 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 90111991-90112917 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 90126975 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Stop codon at position 77 (K77*)
Ref Sequence ENSEMBL: ENSMUSP00000150797 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117141] [ENSMUST00000214356]
AlphaFold Q8VGN8
Predicted Effect probably benign
Transcript: ENSMUST00000117141
Predicted Effect probably null
Transcript: ENSMUST00000214356
AA Change: K77*
Meta Mutation Damage Score 0.9717 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acod1 T G 14: 103,288,776 (GRCm39) D95E probably damaging Het
Agpat4 A G 17: 12,429,209 (GRCm39) T154A possibly damaging Het
Ahnak2 A T 12: 112,742,114 (GRCm39) S653T probably benign Het
Aoc1l2 G A 6: 48,909,620 (GRCm39) V622I probably benign Het
Aox1 C T 1: 58,388,263 (GRCm39) P1124S probably damaging Het
Armh3 A G 19: 45,928,882 (GRCm39) probably null Het
Atp4a T C 7: 30,419,461 (GRCm39) I637T probably damaging Het
Atxn7 T A 14: 14,100,467 (GRCm38) C718S probably damaging Het
Btbd2 T A 10: 80,479,390 (GRCm39) I516F probably damaging Het
Card6 A G 15: 5,134,820 (GRCm39) S128P probably benign Het
Cat T C 2: 103,287,203 (GRCm39) K476E probably benign Het
Ccr9 A T 9: 123,609,022 (GRCm39) T235S probably benign Het
Cep55 T G 19: 38,057,517 (GRCm39) probably null Het
Clec2e A G 6: 129,072,091 (GRCm39) F96S possibly damaging Het
Clk2 G A 3: 89,074,498 (GRCm39) V53I probably benign Het
Clnk T C 5: 38,925,484 (GRCm39) M106V probably benign Het
Col6a5 T C 9: 105,808,523 (GRCm39) I842V unknown Het
Csf1r A T 18: 61,243,572 (GRCm39) N196I probably benign Het
D5Ertd579e A T 5: 36,770,725 (GRCm39) N116K Het
Dnaja4 A G 9: 54,616,494 (GRCm39) I166V probably benign Het
Dqx1 A G 6: 83,038,013 (GRCm39) E467G probably damaging Het
Dync2h1 T C 9: 7,129,719 (GRCm39) T1760A probably benign Het
Eea1 T C 10: 95,864,301 (GRCm39) V940A probably benign Het
Egr1 T A 18: 34,996,598 (GRCm39) V460E probably damaging Het
Eral1 A G 11: 77,965,359 (GRCm39) I352T possibly damaging Het
F2 T C 2: 91,459,041 (GRCm39) H476R possibly damaging Het
Fam83b A G 9: 76,399,714 (GRCm39) V463A possibly damaging Het
Fat1 T C 8: 45,476,359 (GRCm39) S1802P probably damaging Het
Fat1 T A 8: 45,490,374 (GRCm39) L3762H probably damaging Het
Fibp A T 19: 5,514,202 (GRCm39) N296Y probably benign Het
Figla A G 6: 85,994,308 (GRCm39) M28V probably benign Het
Foxd3 C A 4: 99,545,362 (GRCm39) Y167* probably null Het
Gm17019 T A 5: 15,081,006 (GRCm39) H145L probably benign Het
Gm48552 C T 10: 81,226,269 (GRCm39) P18L probably damaging Het
H2-Q6 A G 17: 35,647,077 (GRCm39) N283S probably benign Het
Hrh2 T A 13: 54,368,058 (GRCm39) C11* probably null Het
Hrnr G T 3: 93,239,506 (GRCm39) G3248V unknown Het
Iapp C A 6: 142,249,122 (GRCm39) N58K possibly damaging Het
Itga5 T C 15: 103,258,184 (GRCm39) N837S probably benign Het
Klhl35 C A 7: 99,117,647 (GRCm39) H64N probably benign Het
Lcor T C 19: 41,572,106 (GRCm39) L287S probably benign Het
Lrba T A 3: 86,439,508 (GRCm39) V2015E probably damaging Het
Mdn1 T C 4: 32,734,421 (GRCm39) I3276T probably benign Het
Mlh3 G T 12: 85,315,058 (GRCm39) T376K possibly damaging Het
Muc21 G A 17: 35,932,977 (GRCm39) T403I unknown Het
Nbea A T 3: 55,557,126 (GRCm39) H2550Q probably damaging Het
Nid1 G A 13: 13,663,630 (GRCm39) G763D probably damaging Het
Ntf5 C A 7: 45,065,243 (GRCm39) A125E probably damaging Het
Obsl1 A T 1: 75,480,167 (GRCm39) C460S probably benign Het
Or1j19 A T 2: 36,677,022 (GRCm39) I162F probably benign Het
Or1s2 A T 19: 13,758,650 (GRCm39) R223W probably damaging Het
Or2g7 G A 17: 38,378,566 (GRCm39) C168Y probably damaging Het
Or2y10 T A 11: 49,455,588 (GRCm39) I280N possibly damaging Het
Or6c33 A G 10: 129,853,050 (GRCm39) probably benign Het
Or8d1b G A 9: 38,887,490 (GRCm39) V173I probably benign Het
Orai3 G A 7: 127,372,743 (GRCm39) G130S unknown Het
Pcdhb12 T G 18: 37,568,977 (GRCm39) V41G probably damaging Het
Plec A T 15: 76,067,823 (GRCm39) L1194Q unknown Het
Pml C A 9: 58,127,456 (GRCm39) C763F probably damaging Het
Prdm15 T A 16: 97,619,473 (GRCm39) I318F probably benign Het
Rcbtb2 C A 14: 73,415,906 (GRCm39) T473N probably benign Het
Sbno1 T A 5: 124,512,729 (GRCm39) I1347F probably benign Het
Secisbp2l C T 2: 125,610,113 (GRCm39) D269N probably damaging Het
Serpina9 A T 12: 103,967,575 (GRCm39) F273L probably damaging Het
Sgms2 T A 3: 131,116,898 (GRCm39) Y319F probably benign Het
Sgo2b A T 8: 64,379,531 (GRCm39) H1100Q probably benign Het
Sh3bp5l A T 11: 58,236,754 (GRCm39) probably null Het
Shh T G 5: 28,671,664 (GRCm39) K33T probably benign Het
Slc5a9 A G 4: 111,747,371 (GRCm39) Y339H probably damaging Het
Spice1 T A 16: 44,190,864 (GRCm39) probably null Het
Tbx2 A G 11: 85,726,727 (GRCm39) E257G probably damaging Het
Tenm2 G A 11: 35,914,133 (GRCm39) T2468I possibly damaging Het
Tmeff2 A T 1: 51,018,575 (GRCm39) N186Y probably benign Het
Tmem132c T C 5: 127,631,760 (GRCm39) V673A possibly damaging Het
Trappc11 G T 8: 47,975,411 (GRCm39) T269K probably damaging Het
Trpc6 T C 9: 8,653,150 (GRCm39) F652S possibly damaging Het
Trpv1 G T 11: 73,145,048 (GRCm39) K711N probably benign Het
Vcan G T 13: 89,841,056 (GRCm39) P1496Q probably damaging Het
Vmn1r192 G T 13: 22,371,845 (GRCm39) A125E probably damaging Het
Vti1b A T 12: 79,211,720 (GRCm39) probably null Het
Vwa3b A C 1: 37,163,126 (GRCm39) D583A probably damaging Het
Zfp638 T C 6: 83,953,254 (GRCm39) S1120P probably damaging Het
Zfyve26 A T 12: 79,315,409 (GRCm39) F1356I probably benign Het
Other mutations in Or4b1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01304:Or4b1b APN 2 90,112,425 (GRCm39) missense possibly damaging 0.55
IGL01824:Or4b1b APN 2 90,112,263 (GRCm39) missense probably damaging 1.00
IGL01951:Or4b1b APN 2 90,112,351 (GRCm39) missense probably damaging 1.00
IGL02473:Or4b1b APN 2 90,112,040 (GRCm39) missense probably null 1.00
IGL02494:Or4b1b APN 2 90,112,295 (GRCm39) missense probably benign 0.35
IGL03410:Or4b1b APN 2 90,112,557 (GRCm39) missense probably damaging 1.00
R0350:Or4b1b UTSW 2 90,112,926 (GRCm39) splice site probably null
R0363:Or4b1b UTSW 2 90,112,200 (GRCm39) missense probably damaging 1.00
R0401:Or4b1b UTSW 2 90,112,748 (GRCm39) missense probably damaging 1.00
R0666:Or4b1b UTSW 2 90,112,212 (GRCm39) missense probably damaging 0.96
R1860:Or4b1b UTSW 2 90,112,502 (GRCm39) missense probably damaging 1.00
R1861:Or4b1b UTSW 2 90,112,502 (GRCm39) missense probably damaging 1.00
R2374:Or4b1b UTSW 2 90,112,795 (GRCm39) missense possibly damaging 0.76
R4256:Or4b1b UTSW 2 90,112,406 (GRCm39) missense probably damaging 1.00
R4737:Or4b1b UTSW 2 90,112,725 (GRCm39) missense probably damaging 1.00
R4827:Or4b1b UTSW 2 90,112,547 (GRCm39) missense probably damaging 1.00
R5198:Or4b1b UTSW 2 90,126,737 (GRCm39) missense probably damaging 1.00
R5589:Or4b1b UTSW 2 90,112,313 (GRCm39) missense probably damaging 1.00
R6412:Or4b1b UTSW 2 90,112,202 (GRCm39) missense probably damaging 1.00
R7130:Or4b1b UTSW 2 90,112,266 (GRCm39) missense probably benign
R7317:Or4b1b UTSW 2 90,112,748 (GRCm39) missense probably damaging 1.00
R7497:Or4b1b UTSW 2 90,112,098 (GRCm39) missense possibly damaging 0.74
R8271:Or4b1b UTSW 2 90,112,616 (GRCm39) missense possibly damaging 0.74
R8347:Or4b1b UTSW 2 90,112,020 (GRCm39) missense probably benign 0.22
R8703:Or4b1b UTSW 2 90,126,837 (GRCm39) missense probably damaging 1.00
R8794:Or4b1b UTSW 2 90,112,150 (GRCm39) nonsense probably null
R8824:Or4b1b UTSW 2 90,126,356 (GRCm39) missense probably damaging 0.98
R8910:Or4b1b UTSW 2 90,126,848 (GRCm39) missense possibly damaging 0.80
R8934:Or4b1b UTSW 2 90,112,356 (GRCm39) missense probably benign 0.07
R9548:Or4b1b UTSW 2 90,111,991 (GRCm39) makesense probably null
Predicted Primers PCR Primer
(F):5'- CATGTGACACACTTGACGAC -3'
(R):5'- TGAGTTGATCATCACCGGCC -3'

Sequencing Primer
(F):5'- GTGACACACTTGACGACTCATGATG -3'
(R):5'- TTCCAGGATCCAGATGTGCAG -3'
Posted On 2020-03-13