Mutagenetix > Incidental Mutation

Incidental Mutation 'R7660:Abcb11'

628380

Institutional Source

Beutler Lab

Gene Symbol

Abcb11

Ensembl Gene

ENSMUSG00000027048

Gene Name

ATP-binding cassette, sub-family B (MDR/TAP), member 11

Synonyms

PFIC2, Bsep, PGY4, Lith1, ABC16, sister of P-glycoprotein

MMRRC Submission

Accession Numbers

Genbank: NM_021022; MGI: 1351619

Essential gene?

Possibly essential (E-score: 0.602) question?

Stock #

R7660 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

69238282-69342616 bp(-) (GRCm38)

Type of Mutation

splice site (5 bp from exon)

DNA Base Change (assembly)

C to T at 69287594 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000137017 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102709] [ENSMUST00000102710] [ENSMUST00000180142]

AlphaFold

Q9QY30

Predicted Effect

probably null
Transcript: ENSMUST00000102709

SMART Domains

Protein: ENSMUSP00000099770
Gene: ENSMUSG00000027048

Domain	Start	End	E-Value	Type
Pfam:ABC_membrane	62	373	1.3e-65	PFAM
AAA	447	639	1.65e-17	SMART
Pfam:ABC_membrane	755	1031	2.7e-55	PFAM
AAA	1105	1299	1.9e-17	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000102710

SMART Domains

Protein: ENSMUSP00000099771
Gene: ENSMUSG00000027048

Domain	Start	End	E-Value	Type
Pfam:ABC_membrane	62	371	1.7e-72	PFAM
AAA	447	639	1.65e-17	SMART
Pfam:ABC_membrane	755	1029	3.2e-59	PFAM
AAA	1105	1299	1.9e-17	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000180142

SMART Domains

Protein: ENSMUSP00000137017
Gene: ENSMUSG00000027048

Domain	Start	End	E-Value	Type
Pfam:ABC_membrane	62	371	1.4e-72	PFAM
AAA	447	639	1.65e-17	SMART
Pfam:ABC_membrane	755	1029	2.5e-59	PFAM
AAA	1105	1299	1.9e-17	SMART

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.3%

Validation Efficiency

100% (70/70)

MGI Phenotype

FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance. The protein encoded by this gene is the major canalicular bile salt transporter in humans and mice. Mutations in the human gene cause a form of progressive familial intrahepatic cholestases which are a group of inherited disorders with severe cholestatic liver disease from early infancy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene display intrahepatic cholestasis. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933427I04Rik	A	T	4: 123,860,719	H142L	possibly damaging	Het
Abca13	A	G	11: 9,290,678	E847G	probably benign	Het
Abca9	T	A	11: 110,115,452	T1276S	probably benign	Het
AF366264	A	T	8: 13,837,995	I32K	probably benign	Het
Alpk1	G	C	3: 127,680,967	H462Q	probably damaging	Het
Armh1	C	A	4: 117,213,741	A396S	probably benign	Het
Atm	C	T	9: 53,445,507	V2815M	probably benign	Het
Braf	T	C	6: 39,623,641	I681V	possibly damaging	Het
Casc3	C	G	11: 98,809,873	R4G	unknown	Het
Crybg1	T	C	10: 43,998,835	D759G	probably damaging	Het
Csrp2	A	G	10: 110,937,763	N103S	probably benign	Het
Faf1	A	T	4: 109,861,837	H380L	probably damaging	Het
Farp1	G	A	14: 121,276,922	A888T	probably benign	Het
Fat4	A	T	3: 38,981,160	Q2987L	probably benign	Het
Fkbp15	T	A	4: 62,314,341	T665S	probably benign	Het
Gigyf1	T	C	5: 137,520,969	S343P	probably benign	Het
Glrx3	A	G	7: 137,459,225	Y196C	probably damaging	Het
Gm3278	T	G	14: 4,893,349	L66R	probably damaging	Het
Gm8298	A	G	3: 59,865,268	I64M	probably benign	Het
Ick	G	C	9: 78,167,620	V586L	probably benign	Het
Ifi205	A	G	1: 174,028,248	V72A	probably benign	Het
Ift140	T	G	17: 25,051,824	L708R	probably damaging	Het
Ints13	A	T	6: 146,557,338	L328M	probably benign	Het
Itfg2	A	G	6: 128,424,746	I23T	probably damaging	Het
Ldha	C	T	7: 46,850,257	P100S	unknown	Het
Lmtk2	T	A	5: 144,148,340	L210H	probably damaging	Het
Lrrc4	T	A	6: 28,829,817	I600L	probably benign	Het
Map2	C	A	1: 66,414,377	P809T	probably damaging	Het
Matn2	A	G	15: 34,402,946	K439R	probably benign	Het
Matn2	T	A	15: 34,423,728	C577*	probably null	Het
Mep1a	C	T	17: 43,478,977	G494S	probably benign	Het
Mtmr4	T	C	11: 87,604,580	F488L	probably damaging	Het
Mtus1	G	T	8: 41,016,211	T8K	probably benign	Het
Mug1	C	A	6: 121,861,220	H470N	possibly damaging	Het
Mybpc1	T	C	10: 88,548,854	T523A	possibly damaging	Het
Ncoa3	C	T	2: 166,069,321	P1334S	probably benign	Het
Neb	T	G	2: 52,249,439	M119L		Het
Nox4	T	C	7: 87,370,022	Y408H	probably damaging	Het
Nxpe3	C	T	16: 55,844,327	R510Q	probably damaging	Het
Olfr1077-ps1	A	T	2: 86,525,830	S116T	possibly damaging	Het
Olfr1275	C	T	2: 111,231,615	M59I	probably damaging	Het
Olfr48	T	C	2: 89,844,443	T177A	probably benign	Het
Olfr484	A	G	7: 108,124,834	V143A	probably benign	Het
Olfr807	C	A	10: 129,754,563	E296*	probably null	Het
Olfr839-ps1	T	C	9: 19,175,508	H56R	probably benign	Het
Paip1	C	T	13: 119,450,770	T390I	possibly damaging	Het
Pax8	T	C	2: 24,436,561	Y263C	probably benign	Het
Pcdha11	T	A	18: 37,005,851	Y178N	probably benign	Het
Pcdhga11	C	T	18: 37,757,130	T397M	possibly damaging	Het
Pdlim5	G	T	3: 142,259,185	H428N	probably damaging	Het
Pigg	G	A	5: 108,338,619	V713I	probably benign	Het
Rgs3	A	G	4: 62,701,112	D478G	possibly damaging	Het
Scgb2b11	C	T	7: 32,210,458	E68K	probably damaging	Het
Sema4b	C	A	7: 80,220,247	Q428K	probably benign	Het
Serpine2	T	C	1: 79,802,905	T276A	probably benign	Het
Sgo2b	G	A	8: 63,940,074	H110Y	probably benign	Het
Slc12a7	T	C	13: 73,806,089	L833S	probably benign	Het
Slc6a15	T	A	10: 103,393,380		probably null	Het
Srfbp1	G	A	18: 52,475,599	V24I	probably damaging	Het
Stpg2	A	T	3: 139,701,697	N537Y	probably damaging	Het
Svep1	A	T	4: 58,087,782	S1766T	probably benign	Het
Tiam2	T	A	17: 3,482,605	M1K	probably null	Het
Tmem245	A	T	4: 56,899,170	I661K	possibly damaging	Het
Trim5	T	C	7: 104,279,362	H124R	probably damaging	Het
Trim67	T	A	8: 124,820,285	L478Q	probably damaging	Het
Triml2	A	G	8: 43,193,320	D282G	probably damaging	Het
Txndc11	T	C	16: 11,087,929	Y579C	probably damaging	Het
Ube3c	T	A	5: 29,619,631	D551E	probably damaging	Het
Vmn1r194	T	C	13: 22,244,597	V128A	not run	Het
Vmn2r70	T	G	7: 85,568,922	N56T	probably damaging	Het
Vmn2r-ps130	T	A	17: 23,077,032	D725E	probably damaging	Het
Wdr95	T	C	5: 149,594,480	V501A	possibly damaging	Het
Zc3h8	T	C	2: 128,930,822	T249A	probably damaging	Het
Zfp54	T	C	17: 21,434,239	C332R	probably damaging	Het

Other mutations in Abcb11

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00544:Abcb11	APN	2	69284681	missense	possibly damaging	0.90
IGL01407:Abcb11	APN	2	69245944	missense	probably damaging	1.00
IGL01583:Abcb11	APN	2	69296409	missense	possibly damaging	0.81
IGL01813:Abcb11	APN	2	69287592	splice site	probably benign
IGL01885:Abcb11	APN	2	69287627	missense	probably damaging	1.00
IGL01937:Abcb11	APN	2	69287612	missense	probably damaging	1.00
IGL02058:Abcb11	APN	2	69243498	missense	probably damaging	0.98
IGL02117:Abcb11	APN	2	69323825	splice site	probably benign
IGL02119:Abcb11	APN	2	69328000	critical splice acceptor site	probably null
IGL02120:Abcb11	APN	2	69257310	missense	probably damaging	1.00
IGL02158:Abcb11	APN	2	69299925	missense	probably damaging	0.96
IGL02212:Abcb11	APN	2	69248889	missense	probably damaging	0.97
IGL02306:Abcb11	APN	2	69265457	nonsense	probably null
IGL02505:Abcb11	APN	2	69245761	missense	probably damaging	1.00
IGL02538:Abcb11	APN	2	69306605	missense	possibly damaging	0.67
IGL02793:Abcb11	APN	2	69291949	missense	possibly damaging	0.90
IGL02863:Abcb11	APN	2	69284682	missense	probably damaging	0.99
IGL02875:Abcb11	APN	2	69291949	missense	possibly damaging	0.90
IGL03164:Abcb11	APN	2	69291999	nonsense	probably null
IGL03181:Abcb11	APN	2	69328008	intron	probably benign
3-1:Abcb11	UTSW	2	69327993	missense	probably benign	0.00
FR4737:Abcb11	UTSW	2	69243518	missense	probably damaging	0.97
R0031:Abcb11	UTSW	2	69285308	missense	probably damaging	1.00
R0398:Abcb11	UTSW	2	69286666	missense	probably null	0.82
R0413:Abcb11	UTSW	2	69328011	intron	probably benign
R0437:Abcb11	UTSW	2	69257295	missense	probably damaging	1.00
R0496:Abcb11	UTSW	2	69277884	splice site	probably benign
R0646:Abcb11	UTSW	2	69285283	missense	probably damaging	1.00
R0669:Abcb11	UTSW	2	69329318	missense	probably benign	0.15
R0856:Abcb11	UTSW	2	69323918	missense	probably benign
R1061:Abcb11	UTSW	2	69277809	missense	probably benign	0.00
R1460:Abcb11	UTSW	2	69257374	splice site	probably benign
R1714:Abcb11	UTSW	2	69306581	missense	probably damaging	0.99
R1739:Abcb11	UTSW	2	69261566	missense	probably damaging	1.00
R1856:Abcb11	UTSW	2	69245923	missense	probably damaging	1.00
R1994:Abcb11	UTSW	2	69282670	splice site	probably null
R2086:Abcb11	UTSW	2	69259476	splice site	probably benign
R2133:Abcb11	UTSW	2	69323883	missense	possibly damaging	0.65
R2516:Abcb11	UTSW	2	69329329	missense	possibly damaging	0.88
R2930:Abcb11	UTSW	2	69257358	missense	probably damaging	0.96
R3771:Abcb11	UTSW	2	69329376	splice site	probably benign
R3772:Abcb11	UTSW	2	69329376	splice site	probably benign
R3979:Abcb11	UTSW	2	69323976	missense	probably benign	0.11
R4227:Abcb11	UTSW	2	69284776	missense	probably damaging	1.00
R4255:Abcb11	UTSW	2	69306605	missense	probably benign	0.03
R4614:Abcb11	UTSW	2	69284681	missense	possibly damaging	0.90
R4647:Abcb11	UTSW	2	69285271	missense	probably damaging	1.00
R4719:Abcb11	UTSW	2	69259627	missense	probably damaging	1.00
R4734:Abcb11	UTSW	2	69323962	missense	possibly damaging	0.73
R4765:Abcb11	UTSW	2	69245867	missense	probably damaging	1.00
R4861:Abcb11	UTSW	2	69245905	missense	probably damaging	1.00
R4861:Abcb11	UTSW	2	69245905	missense	probably damaging	1.00
R4870:Abcb11	UTSW	2	69239196	missense	probably damaging	0.99
R4988:Abcb11	UTSW	2	69323892	missense	probably benign	0.12
R5028:Abcb11	UTSW	2	69274012	missense	probably damaging	1.00
R5048:Abcb11	UTSW	2	69308506	missense	probably benign	0.06
R5177:Abcb11	UTSW	2	69285295	missense	probably damaging	1.00
R5301:Abcb11	UTSW	2	69286847	missense	probably damaging	0.98
R5789:Abcb11	UTSW	2	69245764	missense	probably damaging	1.00
R5892:Abcb11	UTSW	2	69261500	missense	probably damaging	0.99
R6003:Abcb11	UTSW	2	69243467	missense	probably benign	0.43
R6252:Abcb11	UTSW	2	69291961	missense	probably benign	0.10
R6389:Abcb11	UTSW	2	69323894	missense	probably damaging	1.00
R6512:Abcb11	UTSW	2	69282652	missense	probably benign
R6590:Abcb11	UTSW	2	69284718	missense	probably damaging	1.00
R6690:Abcb11	UTSW	2	69284718	missense	probably damaging	1.00
R6732:Abcb11	UTSW	2	69286846	missense	probably damaging	1.00
R6870:Abcb11	UTSW	2	69285298	missense	possibly damaging	0.91
R7028:Abcb11	UTSW	2	69265675	missense	probably benign
R7223:Abcb11	UTSW	2	69274143	missense	probably benign
R7323:Abcb11	UTSW	2	69287635	missense	probably damaging	1.00
R7337:Abcb11	UTSW	2	69245769	missense	probably damaging	1.00
R7339:Abcb11	UTSW	2	69299867	missense	probably damaging	0.99
R7340:Abcb11	UTSW	2	69299867	missense	probably damaging	0.99
R7341:Abcb11	UTSW	2	69299867	missense	probably damaging	0.99
R7343:Abcb11	UTSW	2	69299867	missense	probably damaging	0.99
R7366:Abcb11	UTSW	2	69299867	missense	probably damaging	0.99
R7393:Abcb11	UTSW	2	69299867	missense	probably damaging	0.99
R7394:Abcb11	UTSW	2	69299867	missense	probably damaging	0.99
R7405:Abcb11	UTSW	2	69287619	missense	probably damaging	1.00
R7411:Abcb11	UTSW	2	69303936	critical splice donor site	probably null
R7488:Abcb11	UTSW	2	69277802	missense	probably benign
R7544:Abcb11	UTSW	2	69265486	missense	probably benign	0.05
R7754:Abcb11	UTSW	2	69286818	missense	probably damaging	1.00
R7771:Abcb11	UTSW	2	69239191	missense	probably damaging	0.99
R7794:Abcb11	UTSW	2	69286678	missense	possibly damaging	0.62
R7834:Abcb11	UTSW	2	69284724	missense	probably damaging	1.00
R7897:Abcb11	UTSW	2	69323872	frame shift	probably null
R7897:Abcb11	UTSW	2	69323873	small deletion	probably benign
R7937:Abcb11	UTSW	2	69323873	small deletion	probably benign
R8004:Abcb11	UTSW	2	69257210	missense	possibly damaging	0.68
R8089:Abcb11	UTSW	2	69274039	missense	probably benign	0.09
R8279:Abcb11	UTSW	2	69239205	missense	probably benign	0.05
R8426:Abcb11	UTSW	2	69325262	missense	probably benign
R8441:Abcb11	UTSW	2	69257230	missense	possibly damaging	0.93
R8460:Abcb11	UTSW	2	69324037	missense	possibly damaging	0.70
R8462:Abcb11	UTSW	2	69274155	missense	probably benign
R8532:Abcb11	UTSW	2	69259691	missense	possibly damaging	0.69
R8534:Abcb11	UTSW	2	69323846	missense	possibly damaging	0.89
R8711:Abcb11	UTSW	2	69265512	missense	probably damaging	1.00
R8746:Abcb11	UTSW	2	69257410	intron	probably benign
R8964:Abcb11	UTSW	2	69286717	missense	possibly damaging	0.52
R8990:Abcb11	UTSW	2	69274150	missense
R9081:Abcb11	UTSW	2	69292044	missense	possibly damaging	0.59
R9093:Abcb11	UTSW	2	69239169	missense	probably damaging	0.97
R9228:Abcb11	UTSW	2	69308465	nonsense	probably null
R9294:Abcb11	UTSW	2	69265496	missense	possibly damaging	0.89
X0058:Abcb11	UTSW	2	69289443	missense	probably benign	0.12
X0062:Abcb11	UTSW	2	69245906	missense	probably damaging	1.00
X0065:Abcb11	UTSW	2	69299866	missense	probably damaging	0.99
Z1176:Abcb11	UTSW	2	69291981	missense	probably damaging	1.00
Z1177:Abcb11	UTSW	2	69306529	missense	probably damaging	1.00
Z1177:Abcb11	UTSW	2	69329269	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- GCAGTTGAAATTACAAATGTGAGCC -3'
(R):5'- CATTGCTTGGTTAGGTGCAC -3'

Sequencing Primer
(F):5'- GGAGGAAGGAAGGAAGGAAGG -3'
(R):5'- GTTAGGTGCACAGTGACATTATGAAC -3'

Posted On

2020-03-18