Incidental Mutation 'R7660:Abcb11'
ID 628380
Institutional Source Beutler Lab
Gene Symbol Abcb11
Ensembl Gene ENSMUSG00000027048
Gene Name ATP-binding cassette, sub-family B member 11
Synonyms sister of P-glycoprotein, ABC16, PFIC2, Bsep, PGY4, Lith1
MMRRC Submission 045735-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.732) question?
Stock # R7660 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 69068626-69172960 bp(-) (GRCm39)
Type of Mutation splice site (5 bp from exon)
DNA Base Change (assembly) C to T at 69117938 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000137017 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102709] [ENSMUST00000102710] [ENSMUST00000180142]
AlphaFold Q9QY30
Predicted Effect probably null
Transcript: ENSMUST00000102709
SMART Domains Protein: ENSMUSP00000099770
Gene: ENSMUSG00000027048

DomainStartEndE-ValueType
Pfam:ABC_membrane 62 373 1.3e-65 PFAM
AAA 447 639 1.65e-17 SMART
Pfam:ABC_membrane 755 1031 2.7e-55 PFAM
AAA 1105 1299 1.9e-17 SMART
Predicted Effect probably null
Transcript: ENSMUST00000102710
SMART Domains Protein: ENSMUSP00000099771
Gene: ENSMUSG00000027048

DomainStartEndE-ValueType
Pfam:ABC_membrane 62 371 1.7e-72 PFAM
AAA 447 639 1.65e-17 SMART
Pfam:ABC_membrane 755 1029 3.2e-59 PFAM
AAA 1105 1299 1.9e-17 SMART
Predicted Effect probably null
Transcript: ENSMUST00000180142
SMART Domains Protein: ENSMUSP00000137017
Gene: ENSMUSG00000027048

DomainStartEndE-ValueType
Pfam:ABC_membrane 62 371 1.4e-72 PFAM
AAA 447 639 1.65e-17 SMART
Pfam:ABC_membrane 755 1029 2.5e-59 PFAM
AAA 1105 1299 1.9e-17 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.3%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance. The protein encoded by this gene is the major canalicular bile salt transporter in humans and mice. Mutations in the human gene cause a form of progressive familial intrahepatic cholestases which are a group of inherited disorders with severe cholestatic liver disease from early infancy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene display intrahepatic cholestasis. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427I04Rik A T 4: 123,754,512 (GRCm39) H142L possibly damaging Het
Aadacl2fm3 A G 3: 59,772,689 (GRCm39) I64M probably benign Het
Abca13 A G 11: 9,240,678 (GRCm39) E847G probably benign Het
Abca9 T A 11: 110,006,278 (GRCm39) T1276S probably benign Het
Alpk1 G C 3: 127,474,616 (GRCm39) H462Q probably damaging Het
Armh1 C A 4: 117,070,938 (GRCm39) A396S probably benign Het
Atm C T 9: 53,356,807 (GRCm39) V2815M probably benign Het
Braf T C 6: 39,600,575 (GRCm39) I681V possibly damaging Het
Casc3 C G 11: 98,700,699 (GRCm39) R4G unknown Het
Cilk1 G C 9: 78,074,902 (GRCm39) V586L probably benign Het
Crybg1 T C 10: 43,874,831 (GRCm39) D759G probably damaging Het
Csrp2 A G 10: 110,773,624 (GRCm39) N103S probably benign Het
Faf1 A T 4: 109,719,034 (GRCm39) H380L probably damaging Het
Farp1 G A 14: 121,514,334 (GRCm39) A888T probably benign Het
Fat4 A T 3: 39,035,309 (GRCm39) Q2987L probably benign Het
Fkbp15 T A 4: 62,232,578 (GRCm39) T665S probably benign Het
Gigyf1 T C 5: 137,519,231 (GRCm39) S343P probably benign Het
Glrx3 A G 7: 137,060,954 (GRCm39) Y196C probably damaging Het
Gm3278 T G 14: 16,080,387 (GRCm39) L66R probably damaging Het
Ifi205 A G 1: 173,855,814 (GRCm39) V72A probably benign Het
Ift140 T G 17: 25,270,798 (GRCm39) L708R probably damaging Het
Ints13 A T 6: 146,458,836 (GRCm39) L328M probably benign Het
Itfg2 A G 6: 128,401,709 (GRCm39) I23T probably damaging Het
Ldha C T 7: 46,499,681 (GRCm39) P100S unknown Het
Lmtk2 T A 5: 144,085,158 (GRCm39) L210H probably damaging Het
Lrrc4 T A 6: 28,829,816 (GRCm39) I600L probably benign Het
Map2 C A 1: 66,453,536 (GRCm39) P809T probably damaging Het
Matn2 T A 15: 34,423,874 (GRCm39) C577* probably null Het
Matn2 A G 15: 34,403,092 (GRCm39) K439R probably benign Het
Mep1a C T 17: 43,789,868 (GRCm39) G494S probably benign Het
Mtmr4 T C 11: 87,495,406 (GRCm39) F488L probably damaging Het
Mtus1 G T 8: 41,469,248 (GRCm39) T8K probably benign Het
Mug1 C A 6: 121,838,179 (GRCm39) H470N possibly damaging Het
Mybpc1 T C 10: 88,384,716 (GRCm39) T523A possibly damaging Het
Ncoa3 C T 2: 165,911,241 (GRCm39) P1334S probably benign Het
Neb T G 2: 52,139,451 (GRCm39) M119L Het
Nox4 T C 7: 87,019,230 (GRCm39) Y408H probably damaging Het
Nxpe3 C T 16: 55,664,690 (GRCm39) R510Q probably damaging Het
Or4c58 T C 2: 89,674,787 (GRCm39) T177A probably benign Het
Or4f52 C T 2: 111,061,960 (GRCm39) M59I probably damaging Het
Or5p60 A G 7: 107,724,041 (GRCm39) V143A probably benign Het
Or6c214 C A 10: 129,590,432 (GRCm39) E296* probably null Het
Or7g23 T C 9: 19,086,804 (GRCm39) H56R probably benign Het
Or8k31-ps1 A T 2: 86,356,174 (GRCm39) S116T possibly damaging Het
Paip1 C T 13: 119,587,306 (GRCm39) T390I possibly damaging Het
Pax8 T C 2: 24,326,573 (GRCm39) Y263C probably benign Het
Pcdha11 T A 18: 37,138,904 (GRCm39) Y178N probably benign Het
Pcdhga11 C T 18: 37,890,183 (GRCm39) T397M possibly damaging Het
Pdlim5 G T 3: 141,964,946 (GRCm39) H428N probably damaging Het
Pigg G A 5: 108,486,485 (GRCm39) V713I probably benign Het
Rgs3 A G 4: 62,619,349 (GRCm39) D478G possibly damaging Het
Scgb2b11 C T 7: 31,909,883 (GRCm39) E68K probably damaging Het
Sema4b C A 7: 79,869,995 (GRCm39) Q428K probably benign Het
Semp2l2a A T 8: 13,887,995 (GRCm39) I32K probably benign Het
Serpine2 T C 1: 79,780,622 (GRCm39) T276A probably benign Het
Sgo2b G A 8: 64,393,108 (GRCm39) H110Y probably benign Het
Slc12a7 T C 13: 73,954,208 (GRCm39) L833S probably benign Het
Slc6a15 T A 10: 103,229,241 (GRCm39) probably null Het
Srfbp1 G A 18: 52,608,671 (GRCm39) V24I probably damaging Het
Stpg2 A T 3: 139,407,458 (GRCm39) N537Y probably damaging Het
Svep1 A T 4: 58,087,782 (GRCm39) S1766T probably benign Het
Tiam2 T A 17: 3,532,880 (GRCm39) M1K probably null Het
Tmem245 A T 4: 56,899,170 (GRCm39) I661K possibly damaging Het
Trim5 T C 7: 103,928,569 (GRCm39) H124R probably damaging Het
Trim67 T A 8: 125,547,024 (GRCm39) L478Q probably damaging Het
Triml2 A G 8: 43,646,357 (GRCm39) D282G probably damaging Het
Txndc11 T C 16: 10,905,793 (GRCm39) Y579C probably damaging Het
Ube3c T A 5: 29,824,629 (GRCm39) D551E probably damaging Het
Vmn1r194 T C 13: 22,428,767 (GRCm39) V128A not run Het
Vmn2r130 T A 17: 23,296,006 (GRCm39) D725E probably damaging Het
Vmn2r70 T G 7: 85,218,130 (GRCm39) N56T probably damaging Het
Wdr95 T C 5: 149,517,945 (GRCm39) V501A possibly damaging Het
Zc3h8 T C 2: 128,772,742 (GRCm39) T249A probably damaging Het
Zfp54 T C 17: 21,654,501 (GRCm39) C332R probably damaging Het
Other mutations in Abcb11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00544:Abcb11 APN 2 69,115,025 (GRCm39) missense possibly damaging 0.90
IGL01407:Abcb11 APN 2 69,076,288 (GRCm39) missense probably damaging 1.00
IGL01583:Abcb11 APN 2 69,126,753 (GRCm39) missense possibly damaging 0.81
IGL01813:Abcb11 APN 2 69,117,936 (GRCm39) splice site probably benign
IGL01885:Abcb11 APN 2 69,117,971 (GRCm39) missense probably damaging 1.00
IGL01937:Abcb11 APN 2 69,117,956 (GRCm39) missense probably damaging 1.00
IGL02058:Abcb11 APN 2 69,073,842 (GRCm39) missense probably damaging 0.98
IGL02117:Abcb11 APN 2 69,154,169 (GRCm39) splice site probably benign
IGL02119:Abcb11 APN 2 69,158,344 (GRCm39) critical splice acceptor site probably null
IGL02120:Abcb11 APN 2 69,087,654 (GRCm39) missense probably damaging 1.00
IGL02158:Abcb11 APN 2 69,130,269 (GRCm39) missense probably damaging 0.96
IGL02212:Abcb11 APN 2 69,079,233 (GRCm39) missense probably damaging 0.97
IGL02306:Abcb11 APN 2 69,095,801 (GRCm39) nonsense probably null
IGL02505:Abcb11 APN 2 69,076,105 (GRCm39) missense probably damaging 1.00
IGL02538:Abcb11 APN 2 69,136,949 (GRCm39) missense possibly damaging 0.67
IGL02793:Abcb11 APN 2 69,122,293 (GRCm39) missense possibly damaging 0.90
IGL02863:Abcb11 APN 2 69,115,026 (GRCm39) missense probably damaging 0.99
IGL02875:Abcb11 APN 2 69,122,293 (GRCm39) missense possibly damaging 0.90
IGL03164:Abcb11 APN 2 69,122,343 (GRCm39) nonsense probably null
IGL03181:Abcb11 APN 2 69,158,352 (GRCm39) intron probably benign
3-1:Abcb11 UTSW 2 69,158,337 (GRCm39) missense probably benign 0.00
FR4737:Abcb11 UTSW 2 69,073,862 (GRCm39) missense probably damaging 0.97
R0031:Abcb11 UTSW 2 69,115,652 (GRCm39) missense probably damaging 1.00
R0398:Abcb11 UTSW 2 69,117,010 (GRCm39) missense probably null 0.82
R0413:Abcb11 UTSW 2 69,158,355 (GRCm39) intron probably benign
R0437:Abcb11 UTSW 2 69,087,639 (GRCm39) missense probably damaging 1.00
R0496:Abcb11 UTSW 2 69,108,228 (GRCm39) splice site probably benign
R0646:Abcb11 UTSW 2 69,115,627 (GRCm39) missense probably damaging 1.00
R0669:Abcb11 UTSW 2 69,159,662 (GRCm39) missense probably benign 0.15
R0856:Abcb11 UTSW 2 69,154,262 (GRCm39) missense probably benign
R1061:Abcb11 UTSW 2 69,108,153 (GRCm39) missense probably benign 0.00
R1460:Abcb11 UTSW 2 69,087,718 (GRCm39) splice site probably benign
R1714:Abcb11 UTSW 2 69,136,925 (GRCm39) missense probably damaging 0.99
R1739:Abcb11 UTSW 2 69,091,910 (GRCm39) missense probably damaging 1.00
R1856:Abcb11 UTSW 2 69,076,267 (GRCm39) missense probably damaging 1.00
R1994:Abcb11 UTSW 2 69,113,014 (GRCm39) splice site probably null
R2086:Abcb11 UTSW 2 69,089,820 (GRCm39) splice site probably benign
R2133:Abcb11 UTSW 2 69,154,227 (GRCm39) missense possibly damaging 0.65
R2516:Abcb11 UTSW 2 69,159,673 (GRCm39) missense possibly damaging 0.88
R2930:Abcb11 UTSW 2 69,087,702 (GRCm39) missense probably damaging 0.96
R3771:Abcb11 UTSW 2 69,159,720 (GRCm39) splice site probably benign
R3772:Abcb11 UTSW 2 69,159,720 (GRCm39) splice site probably benign
R3979:Abcb11 UTSW 2 69,154,320 (GRCm39) missense probably benign 0.11
R4227:Abcb11 UTSW 2 69,115,120 (GRCm39) missense probably damaging 1.00
R4255:Abcb11 UTSW 2 69,136,949 (GRCm39) missense probably benign 0.03
R4614:Abcb11 UTSW 2 69,115,025 (GRCm39) missense possibly damaging 0.90
R4647:Abcb11 UTSW 2 69,115,615 (GRCm39) missense probably damaging 1.00
R4719:Abcb11 UTSW 2 69,089,971 (GRCm39) missense probably damaging 1.00
R4734:Abcb11 UTSW 2 69,154,306 (GRCm39) missense possibly damaging 0.73
R4765:Abcb11 UTSW 2 69,076,211 (GRCm39) missense probably damaging 1.00
R4861:Abcb11 UTSW 2 69,076,249 (GRCm39) missense probably damaging 1.00
R4861:Abcb11 UTSW 2 69,076,249 (GRCm39) missense probably damaging 1.00
R4870:Abcb11 UTSW 2 69,069,540 (GRCm39) missense probably damaging 0.99
R4988:Abcb11 UTSW 2 69,154,236 (GRCm39) missense probably benign 0.12
R5028:Abcb11 UTSW 2 69,104,356 (GRCm39) missense probably damaging 1.00
R5048:Abcb11 UTSW 2 69,138,850 (GRCm39) missense probably benign 0.06
R5177:Abcb11 UTSW 2 69,115,639 (GRCm39) missense probably damaging 1.00
R5301:Abcb11 UTSW 2 69,117,191 (GRCm39) missense probably damaging 0.98
R5789:Abcb11 UTSW 2 69,076,108 (GRCm39) missense probably damaging 1.00
R5892:Abcb11 UTSW 2 69,091,844 (GRCm39) missense probably damaging 0.99
R6003:Abcb11 UTSW 2 69,073,811 (GRCm39) missense probably benign 0.43
R6252:Abcb11 UTSW 2 69,122,305 (GRCm39) missense probably benign 0.10
R6389:Abcb11 UTSW 2 69,154,238 (GRCm39) missense probably damaging 1.00
R6512:Abcb11 UTSW 2 69,112,996 (GRCm39) missense probably benign
R6590:Abcb11 UTSW 2 69,115,062 (GRCm39) missense probably damaging 1.00
R6690:Abcb11 UTSW 2 69,115,062 (GRCm39) missense probably damaging 1.00
R6732:Abcb11 UTSW 2 69,117,190 (GRCm39) missense probably damaging 1.00
R6870:Abcb11 UTSW 2 69,115,642 (GRCm39) missense possibly damaging 0.91
R7028:Abcb11 UTSW 2 69,096,019 (GRCm39) missense probably benign
R7223:Abcb11 UTSW 2 69,104,487 (GRCm39) missense probably benign
R7323:Abcb11 UTSW 2 69,117,979 (GRCm39) missense probably damaging 1.00
R7337:Abcb11 UTSW 2 69,076,113 (GRCm39) missense probably damaging 1.00
R7339:Abcb11 UTSW 2 69,130,211 (GRCm39) missense probably damaging 0.99
R7340:Abcb11 UTSW 2 69,130,211 (GRCm39) missense probably damaging 0.99
R7341:Abcb11 UTSW 2 69,130,211 (GRCm39) missense probably damaging 0.99
R7343:Abcb11 UTSW 2 69,130,211 (GRCm39) missense probably damaging 0.99
R7366:Abcb11 UTSW 2 69,130,211 (GRCm39) missense probably damaging 0.99
R7393:Abcb11 UTSW 2 69,130,211 (GRCm39) missense probably damaging 0.99
R7394:Abcb11 UTSW 2 69,130,211 (GRCm39) missense probably damaging 0.99
R7405:Abcb11 UTSW 2 69,117,963 (GRCm39) missense probably damaging 1.00
R7411:Abcb11 UTSW 2 69,134,280 (GRCm39) critical splice donor site probably null
R7488:Abcb11 UTSW 2 69,108,146 (GRCm39) missense probably benign
R7544:Abcb11 UTSW 2 69,095,830 (GRCm39) missense probably benign 0.05
R7754:Abcb11 UTSW 2 69,117,162 (GRCm39) missense probably damaging 1.00
R7771:Abcb11 UTSW 2 69,069,535 (GRCm39) missense probably damaging 0.99
R7794:Abcb11 UTSW 2 69,117,022 (GRCm39) missense possibly damaging 0.62
R7834:Abcb11 UTSW 2 69,115,068 (GRCm39) missense probably damaging 1.00
R7897:Abcb11 UTSW 2 69,154,217 (GRCm39) small deletion probably benign
R7897:Abcb11 UTSW 2 69,154,216 (GRCm39) frame shift probably null
R7937:Abcb11 UTSW 2 69,154,217 (GRCm39) small deletion probably benign
R8004:Abcb11 UTSW 2 69,087,554 (GRCm39) missense possibly damaging 0.68
R8089:Abcb11 UTSW 2 69,104,383 (GRCm39) missense probably benign 0.09
R8279:Abcb11 UTSW 2 69,069,549 (GRCm39) missense probably benign 0.05
R8426:Abcb11 UTSW 2 69,155,606 (GRCm39) missense probably benign
R8441:Abcb11 UTSW 2 69,087,574 (GRCm39) missense possibly damaging 0.93
R8460:Abcb11 UTSW 2 69,154,381 (GRCm39) missense possibly damaging 0.70
R8462:Abcb11 UTSW 2 69,104,499 (GRCm39) missense probably benign
R8532:Abcb11 UTSW 2 69,090,035 (GRCm39) missense possibly damaging 0.69
R8534:Abcb11 UTSW 2 69,154,190 (GRCm39) missense possibly damaging 0.89
R8711:Abcb11 UTSW 2 69,095,856 (GRCm39) missense probably damaging 1.00
R8746:Abcb11 UTSW 2 69,087,754 (GRCm39) intron probably benign
R8964:Abcb11 UTSW 2 69,117,061 (GRCm39) missense possibly damaging 0.52
R8990:Abcb11 UTSW 2 69,104,494 (GRCm39) missense
R9081:Abcb11 UTSW 2 69,122,388 (GRCm39) missense possibly damaging 0.59
R9093:Abcb11 UTSW 2 69,069,513 (GRCm39) missense probably damaging 0.97
R9228:Abcb11 UTSW 2 69,138,809 (GRCm39) nonsense probably null
R9294:Abcb11 UTSW 2 69,095,840 (GRCm39) missense possibly damaging 0.89
X0058:Abcb11 UTSW 2 69,119,787 (GRCm39) missense probably benign 0.12
X0062:Abcb11 UTSW 2 69,076,250 (GRCm39) missense probably damaging 1.00
X0065:Abcb11 UTSW 2 69,130,210 (GRCm39) missense probably damaging 0.99
Z1176:Abcb11 UTSW 2 69,122,325 (GRCm39) missense probably damaging 1.00
Z1177:Abcb11 UTSW 2 69,159,613 (GRCm39) critical splice donor site probably null
Z1177:Abcb11 UTSW 2 69,136,873 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGTTGAAATTACAAATGTGAGCC -3'
(R):5'- CATTGCTTGGTTAGGTGCAC -3'

Sequencing Primer
(F):5'- GGAGGAAGGAAGGAAGGAAGG -3'
(R):5'- GTTAGGTGCACAGTGACATTATGAAC -3'
Posted On 2020-03-18