Incidental Mutation 'R7688:Rab25'
ID628383
Institutional Source Beutler Lab
Gene Symbol Rab25
Ensembl Gene ENSMUSG00000008601
Gene NameRAB25, member RAS oncogene family
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R7688 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location88542029-88548300 bp(-) (GRCm38)
Type of Mutationintron (98 bp from exon)
DNA Base Change (assembly) A to T at 88544963 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120505 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008745] [ENSMUST00000029698] [ENSMUST00000119002] [ENSMUST00000131775] [ENSMUST00000172699]
Predicted Effect probably null
Transcript: ENSMUST00000008745
SMART Domains Protein: ENSMUSP00000008745
Gene: ENSMUSG00000008601

DomainStartEndE-ValueType
RAB 13 176 2.1e-95 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000029698
SMART Domains Protein: ENSMUSP00000029698
Gene: ENSMUSG00000028062

DomainStartEndE-ValueType
Robl_LC7 7 95 2.65e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119002
SMART Domains Protein: ENSMUSP00000112936
Gene: ENSMUSG00000028062

DomainStartEndE-ValueType
Blast:Robl_LC7 1 22 2e-8 BLAST
PDB:3CPT|B 1 52 2e-32 PDB
Predicted Effect probably null
Transcript: ENSMUST00000131775
SMART Domains Protein: ENSMUSP00000120505
Gene: ENSMUSG00000008601

DomainStartEndE-ValueType
RAB 3 122 6.15e-47 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172699
SMART Domains Protein: ENSMUSP00000134222
Gene: ENSMUSG00000074480

DomainStartEndE-ValueType
low complexity region 14 24 N/A INTRINSIC
low complexity region 37 51 N/A INTRINSIC
low complexity region 53 110 N/A INTRINSIC
KH 130 198 3.35e-9 SMART
KH 222 289 4.59e-16 SMART
low complexity region 406 415 N/A INTRINSIC
RING 469 508 1.39e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the RAS superfamily of small GTPases. The encoded protein is involved in membrane trafficking and cell survival. This gene has been found to be a tumor suppressor and an oncogene, depending on the context. Two variants, one protein-coding and the other not, have been found for this gene. [provided by RefSeq, Nov 2015]
PHENOTYPE: On a 129 background, virgin female homozygotes older than 10 months of age develop vaginal cancer while both male and female homozygotes develop distal esophageal stricture due to squamous cell hyperplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bag6 T C 17: 35,146,892 Y1102H probably damaging Het
Cldn24 G A 8: 47,822,705 C188Y probably damaging Het
Dennd4c T C 4: 86,795,140 W443R probably damaging Het
Dmxl1 T A 18: 49,955,871 C2806S probably benign Het
Epb41l2 T C 10: 25,479,138 Y449H probably damaging Het
Ets1 T A 9: 32,696,424 I14N probably benign Het
F11 A T 8: 45,250,090 F188I probably damaging Het
Fam13a C T 6: 58,935,707 V654I probably benign Het
Flt1 C T 5: 147,676,325 V369I probably benign Het
Focad T A 4: 88,178,133 Y251N probably damaging Het
Gm14025 G A 2: 129,039,044 Q321* probably null Het
Gm5150 A G 3: 15,963,583 S175P probably benign Het
Hnrnpul2 T A 19: 8,820,630 S117T probably benign Het
Kcnj5 A G 9: 32,322,968 V17A probably benign Het
Kctd1 T G 18: 14,974,198 T737P probably benign Het
Kif14 T C 1: 136,494,654 V894A probably damaging Het
Klhl12 A T 1: 134,489,030 T497S probably benign Het
Klhl6 C A 16: 19,947,131 V574L probably damaging Het
Lama1 A T 17: 67,761,628 D774V Het
Leng1 G A 7: 3,662,810 P176L probably benign Het
Lig1 T C 7: 13,289,463 L196P probably benign Het
Macrod1 C A 19: 7,196,865 Y245* probably null Het
Mcf2l T A 8: 12,948,130 I6N possibly damaging Het
Megf11 A G 9: 64,691,864 D687G possibly damaging Het
Muc4 A T 16: 32,751,460 H446L possibly damaging Het
Oasl2 A T 5: 114,897,848 I62F probably benign Het
Olfr1271 A T 2: 90,265,615 F272I probably damaging Het
Olfr298 A G 7: 86,488,975 V192A probably benign Het
Olfr671 C A 7: 104,975,125 A291S possibly damaging Het
Oog4 CAA CA 4: 143,437,452 probably null Het
Pdcl2 T C 5: 76,317,923 N150S probably benign Het
Pfkfb3 A G 2: 11,492,639 Y54H probably damaging Het
Slc22a18 G A 7: 143,479,823 G104S probably damaging Het
Slc44a5 T A 3: 153,973,800 probably null Het
Slc5a8 A G 10: 88,921,699 Y517C probably damaging Het
Spata18 A G 5: 73,651,662 N26S probably benign Het
Tas2r115 T A 6: 132,737,680 S103C probably damaging Het
Tigd2 T A 6: 59,210,397 M83K probably damaging Het
Tnxb T A 17: 34,671,906 C408S probably benign Het
Trbj2-3 T A 6: 41,543,225 S1R possibly damaging Het
Triobp T C 15: 78,961,111 probably null Het
Uaca A G 9: 60,874,127 Q1349R probably benign Het
Ube2j2 T A 4: 155,956,428 L171I probably damaging Het
Usp17ld C A 7: 103,250,775 G317W probably damaging Het
Vmn2r72 T A 7: 85,754,890 D31V probably benign Het
Zfp317 T G 9: 19,647,955 H488Q probably damaging Het
Other mutations in Rab25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Rab25 APN 3 88545239 missense probably damaging 1.00
IGL02444:Rab25 APN 3 88542713 missense probably benign 0.24
IGL03098:Rab25 UTSW 3 88542260 missense probably damaging 1.00
R0165:Rab25 UTSW 3 88548055 missense probably benign 0.00
R1980:Rab25 UTSW 3 88543458 missense probably damaging 0.97
R5175:Rab25 UTSW 3 88543421 missense possibly damaging 0.95
R6612:Rab25 UTSW 3 88543403 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTACTCAAAGAGCTCCACAGAATG -3'
(R):5'- CAATGAGTTCAGCCACGACAG -3'

Sequencing Primer
(F):5'- GCTCCACAGAATGCCAGGTAG -3'
(R):5'- ACCCGCACTGTAATGCTG -3'
Posted On2020-03-18