Incidental Mutation 'R7688:Triobp'
ID628387
Institutional Source Beutler Lab
Gene Symbol Triobp
Ensembl Gene ENSMUSG00000033088
Gene NameTRIO and F-actin binding protein
SynonymsEST478828, Mus EST 478828, Tara
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7688 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location78947724-79005869 bp(+) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) T to C at 78961111 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000155397 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109689] [ENSMUST00000109690] [ENSMUST00000140228] [ENSMUST00000229943]
Predicted Effect probably null
Transcript: ENSMUST00000109689
SMART Domains Protein: ENSMUSP00000105311
Gene: ENSMUSG00000033088

DomainStartEndE-ValueType
low complexity region 130 154 N/A INTRINSIC
low complexity region 291 311 N/A INTRINSIC
internal_repeat_1 312 394 7.43e-13 PROSPERO
internal_repeat_1 390 540 7.43e-13 PROSPERO
low complexity region 585 600 N/A INTRINSIC
low complexity region 638 657 N/A INTRINSIC
low complexity region 697 729 N/A INTRINSIC
low complexity region 767 777 N/A INTRINSIC
low complexity region 885 901 N/A INTRINSIC
low complexity region 903 923 N/A INTRINSIC
low complexity region 995 1017 N/A INTRINSIC
low complexity region 1054 1068 N/A INTRINSIC
low complexity region 1221 1235 N/A INTRINSIC
PH 1395 1492 6.2e-19 SMART
coiled coil region 1665 1692 N/A INTRINSIC
coiled coil region 1727 1765 N/A INTRINSIC
coiled coil region 1789 1851 N/A INTRINSIC
coiled coil region 1885 1964 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000109690
SMART Domains Protein: ENSMUSP00000105312
Gene: ENSMUSG00000033088

DomainStartEndE-ValueType
low complexity region 130 154 N/A INTRINSIC
low complexity region 291 311 N/A INTRINSIC
internal_repeat_1 312 394 9.24e-13 PROSPERO
internal_repeat_1 390 540 9.24e-13 PROSPERO
low complexity region 585 600 N/A INTRINSIC
low complexity region 638 657 N/A INTRINSIC
low complexity region 697 729 N/A INTRINSIC
low complexity region 767 777 N/A INTRINSIC
low complexity region 885 901 N/A INTRINSIC
low complexity region 903 923 N/A INTRINSIC
low complexity region 995 1017 N/A INTRINSIC
low complexity region 1054 1068 N/A INTRINSIC
low complexity region 1221 1235 N/A INTRINSIC
PH 1441 1538 6.2e-19 SMART
coiled coil region 1711 1738 N/A INTRINSIC
coiled coil region 1773 1811 N/A INTRINSIC
coiled coil region 1835 1897 N/A INTRINSIC
coiled coil region 1931 2010 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000140228
Predicted Effect probably benign
Transcript: ENSMUST00000229943
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: This gene encodes a protein that interacts with trio, which is involved with neural tissue development and controlling actin cytoskeleton organization, cell motility, and cell growth. The encoded protein also associates with F-actin and stabilizes F-actin structures. Domains contained in this encoded protein are an N-terminal pleckstrin homology domain and a C-terminal coiled-coil region. Mutations in the human gene have been associated with a form of autosomal recessive nonsyndromic deafness. Multiple alternatively spliced transcript variants have been described [provided by RefSeq, Sep 2012]
PHENOTYPE: Mice homozygous for gene trapped alleles exhibit embryonic lethality. Mice homozygous for a targeted allele eliminating isoforms 4 and 5 exhibit profound deafness associated with stereocilia fragility and degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bag6 T C 17: 35,146,892 Y1102H probably damaging Het
Cldn24 G A 8: 47,822,705 C188Y probably damaging Het
Dennd4c T C 4: 86,795,140 W443R probably damaging Het
Dmxl1 T A 18: 49,955,871 C2806S probably benign Het
Epb41l2 T C 10: 25,479,138 Y449H probably damaging Het
Ets1 T A 9: 32,696,424 I14N probably benign Het
F11 A T 8: 45,250,090 F188I probably damaging Het
Fam13a C T 6: 58,935,707 V654I probably benign Het
Flt1 C T 5: 147,676,325 V369I probably benign Het
Focad T A 4: 88,178,133 Y251N probably damaging Het
Gm14025 G A 2: 129,039,044 Q321* probably null Het
Gm5150 A G 3: 15,963,583 S175P probably benign Het
Hnrnpul2 T A 19: 8,820,630 S117T probably benign Het
Kcnj5 A G 9: 32,322,968 V17A probably benign Het
Kctd1 T G 18: 14,974,198 T737P probably benign Het
Kif14 T C 1: 136,494,654 V894A probably damaging Het
Klhl12 A T 1: 134,489,030 T497S probably benign Het
Klhl6 C A 16: 19,947,131 V574L probably damaging Het
Lama1 A T 17: 67,761,628 D774V Het
Leng1 G A 7: 3,662,810 P176L probably benign Het
Lig1 T C 7: 13,289,463 L196P probably benign Het
Macrod1 C A 19: 7,196,865 Y245* probably null Het
Mcf2l T A 8: 12,948,130 I6N possibly damaging Het
Megf11 A G 9: 64,691,864 D687G possibly damaging Het
Muc4 A T 16: 32,751,460 H446L possibly damaging Het
Oasl2 A T 5: 114,897,848 I62F probably benign Het
Olfr1271 A T 2: 90,265,615 F272I probably damaging Het
Olfr298 A G 7: 86,488,975 V192A probably benign Het
Olfr671 C A 7: 104,975,125 A291S possibly damaging Het
Oog4 CAA CA 4: 143,437,452 probably null Het
Pdcl2 T C 5: 76,317,923 N150S probably benign Het
Pfkfb3 A G 2: 11,492,639 Y54H probably damaging Het
Rab25 A T 3: 88,544,963 probably null Het
Slc22a18 G A 7: 143,479,823 G104S probably damaging Het
Slc44a5 T A 3: 153,973,800 probably null Het
Slc5a8 A G 10: 88,921,699 Y517C probably damaging Het
Spata18 A G 5: 73,651,662 N26S probably benign Het
Tas2r115 T A 6: 132,737,680 S103C probably damaging Het
Tigd2 T A 6: 59,210,397 M83K probably damaging Het
Tnxb T A 17: 34,671,906 C408S probably benign Het
Trbj2-3 T A 6: 41,543,225 S1R possibly damaging Het
Uaca A G 9: 60,874,127 Q1349R probably benign Het
Ube2j2 T A 4: 155,956,428 L171I probably damaging Het
Usp17ld C A 7: 103,250,775 G317W probably damaging Het
Vmn2r72 T A 7: 85,754,890 D31V probably benign Het
Zfp317 T G 9: 19,647,955 H488Q probably damaging Het
Other mutations in Triobp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01634:Triobp APN 15 78993368 missense probably damaging 1.00
IGL01904:Triobp APN 15 78967364 missense possibly damaging 0.80
IGL01957:Triobp APN 15 78972647 critical splice donor site probably null
IGL02085:Triobp APN 15 78974297 splice site probably benign
IGL02260:Triobp APN 15 78966362 missense probably benign 0.00
IGL02498:Triobp APN 15 78961043 missense probably benign 0.01
IGL02551:Triobp APN 15 78973489 missense probably benign
IGL02740:Triobp APN 15 78966689 missense probably benign 0.21
IGL02810:Triobp APN 15 79002203 missense possibly damaging 0.95
IGL03063:Triobp APN 15 78990884 missense probably damaging 1.00
FR4304:Triobp UTSW 15 78993387 unclassified probably benign
FR4340:Triobp UTSW 15 78993390 unclassified probably benign
FR4342:Triobp UTSW 15 78993392 unclassified probably benign
FR4449:Triobp UTSW 15 78993389 unclassified probably benign
FR4548:Triobp UTSW 15 78993387 unclassified probably benign
FR4548:Triobp UTSW 15 78993390 unclassified probably benign
R0276:Triobp UTSW 15 78973676 missense probably benign 0.09
R0309:Triobp UTSW 15 78976540 missense probably damaging 1.00
R0433:Triobp UTSW 15 78968201 missense possibly damaging 0.69
R0464:Triobp UTSW 15 78966986 missense possibly damaging 0.71
R0525:Triobp UTSW 15 78973898 missense possibly damaging 0.93
R0665:Triobp UTSW 15 78973898 missense possibly damaging 0.93
R0689:Triobp UTSW 15 78959988 nonsense probably null
R1149:Triobp UTSW 15 78966479 missense probably benign 0.00
R1149:Triobp UTSW 15 78966479 missense probably benign 0.00
R1151:Triobp UTSW 15 78966479 missense probably benign 0.00
R1152:Triobp UTSW 15 78966479 missense probably benign 0.00
R1510:Triobp UTSW 15 79003767 missense probably damaging 1.00
R1519:Triobp UTSW 15 78973738 missense probably benign 0.00
R1642:Triobp UTSW 15 79002148 missense probably damaging 1.00
R1732:Triobp UTSW 15 78967228 missense possibly damaging 0.69
R1755:Triobp UTSW 15 78966479 missense probably benign 0.00
R1975:Triobp UTSW 15 78966708 missense probably benign
R2051:Triobp UTSW 15 79004540 missense probably damaging 1.00
R2073:Triobp UTSW 15 78973895 missense probably damaging 0.99
R2260:Triobp UTSW 15 78991440 critical splice donor site probably null
R2351:Triobp UTSW 15 79004580 missense probably benign 0.09
R2902:Triobp UTSW 15 78973418 missense possibly damaging 0.90
R3801:Triobp UTSW 15 78973700 missense probably benign 0.04
R3959:Triobp UTSW 15 79002389 nonsense probably null
R4003:Triobp UTSW 15 78959977 unclassified probably benign
R4084:Triobp UTSW 15 78973671 missense probably benign 0.19
R4482:Triobp UTSW 15 78966563 missense possibly damaging 0.87
R4592:Triobp UTSW 15 78967095 missense probably benign
R4662:Triobp UTSW 15 78993269 missense probably damaging 1.00
R4732:Triobp UTSW 15 78967113 missense probably damaging 0.99
R4733:Triobp UTSW 15 78967113 missense probably damaging 0.99
R4789:Triobp UTSW 15 78991028 missense probably damaging 1.00
R4968:Triobp UTSW 15 78966616 missense probably benign 0.03
R4990:Triobp UTSW 15 78967005 missense probably benign 0.00
R5129:Triobp UTSW 15 78961096 missense probably benign 0.15
R5181:Triobp UTSW 15 78967754 missense probably benign 0.00
R5279:Triobp UTSW 15 78994391 missense possibly damaging 0.66
R5584:Triobp UTSW 15 78968132 missense possibly damaging 0.89
R5601:Triobp UTSW 15 78973633 missense probably damaging 1.00
R5810:Triobp UTSW 15 78968267 missense probably benign 0.07
R5969:Triobp UTSW 15 78967540 missense probably benign 0.05
R6722:Triobp UTSW 15 79001565 missense probably damaging 1.00
R6739:Triobp UTSW 15 78966366 missense possibly damaging 0.77
R6810:Triobp UTSW 15 78966615 missense possibly damaging 0.47
R7011:Triobp UTSW 15 78978723 missense probably damaging 0.98
R7015:Triobp UTSW 15 78994060 missense probably damaging 0.99
R7200:Triobp UTSW 15 78966842 small deletion probably benign
R7294:Triobp UTSW 15 78973976 missense probably damaging 0.99
R7805:Triobp UTSW 15 78974004 missense probably benign 0.37
R7999:Triobp UTSW 15 78959944 missense probably damaging 0.99
RF001:Triobp UTSW 15 78967027 small insertion probably benign
RF005:Triobp UTSW 15 78967061 small insertion probably benign
RF007:Triobp UTSW 15 78967044 small insertion probably benign
RF022:Triobp UTSW 15 78974282 missense probably benign 0.05
RF028:Triobp UTSW 15 78967039 small insertion probably benign
RF032:Triobp UTSW 15 78967036 small insertion probably benign
RF035:Triobp UTSW 15 78967039 small insertion probably benign
RF039:Triobp UTSW 15 78967036 small insertion probably benign
RF039:Triobp UTSW 15 78967039 small insertion probably benign
RF040:Triobp UTSW 15 78967063 small insertion probably benign
RF049:Triobp UTSW 15 78967061 small insertion probably benign
RF051:Triobp UTSW 15 78967034 small insertion probably benign
RF058:Triobp UTSW 15 78967044 small insertion probably benign
X0026:Triobp UTSW 15 78960023 missense possibly damaging 0.94
Z1177:Triobp UTSW 15 79002181 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTTAGCAGGATTGGGACACTAC -3'
(R):5'- TGGCACACCATAAAGGAATGTC -3'

Sequencing Primer
(F):5'- TTGGGACACTACTGAGAGACC -3'
(R):5'- ATCTCTGAGAGTTCAAGGCCAGC -3'
Posted On2020-03-18