Incidental Mutation 'R7678:Adam22'
ID628399
Institutional Source Beutler Lab
Gene Symbol Adam22
Ensembl Gene ENSMUSG00000040537
Gene Namea disintegrin and metallopeptidase domain 22
Synonyms2900022I03Rik, MDC2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7678 (G1)
Quality Score85.0076
Status Validated
Chromosome5
Chromosomal Location8072352-8368160 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to A at 8087750 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119409 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046838] [ENSMUST00000050166] [ENSMUST00000088744] [ENSMUST00000088761] [ENSMUST00000115386] [ENSMUST00000115388] [ENSMUST00000123168] [ENSMUST00000126384] [ENSMUST00000130315] [ENSMUST00000136524] [ENSMUST00000136808] [ENSMUST00000139048] [ENSMUST00000139841] [ENSMUST00000144241] [ENSMUST00000153427] [ENSMUST00000153889] [ENSMUST00000154935] [ENSMUST00000197700] [ENSMUST00000199853]
Predicted Effect probably benign
Transcript: ENSMUST00000046838
SMART Domains Protein: ENSMUSP00000049120
Gene: ENSMUSG00000040537

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Pep_M12B_propep 44 186 7e-27 PFAM
low complexity region 214 230 N/A INTRINSIC
Pfam:Reprolysin_5 235 405 9.3e-9 PFAM
Pfam:Reprolysin 237 436 1.1e-58 PFAM
Pfam:Reprolysin_3 261 379 3e-12 PFAM
DISIN 451 527 3.38e-31 SMART
ACR 528 669 3.05e-58 SMART
EGF 676 710 1.28e1 SMART
transmembrane domain 735 757 N/A INTRINSIC
low complexity region 789 808 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000050166
SMART Domains Protein: ENSMUSP00000055000
Gene: ENSMUSG00000040537

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Pep_M12B_propep 44 186 7.6e-27 PFAM
low complexity region 214 230 N/A INTRINSIC
Pfam:Reprolysin_5 235 405 1.1e-8 PFAM
Pfam:Reprolysin 237 436 1.1e-58 PFAM
Pfam:Reprolysin_3 261 379 3.4e-12 PFAM
DISIN 451 527 3.38e-31 SMART
ACR 528 669 3.05e-58 SMART
EGF 676 710 1.28e1 SMART
transmembrane domain 735 757 N/A INTRINSIC
low complexity region 824 839 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000088744
SMART Domains Protein: ENSMUSP00000086122
Gene: ENSMUSG00000040537

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Pep_M12B_propep 41 186 4.2e-29 PFAM
low complexity region 214 230 N/A INTRINSIC
Pfam:Reprolysin_5 235 405 1.2e-8 PFAM
Pfam:Reprolysin 237 436 2.9e-65 PFAM
Pfam:Reprolysin_3 261 378 9.2e-13 PFAM
DISIN 451 527 3.38e-31 SMART
ACR 528 669 3.05e-58 SMART
EGF 676 710 1.28e1 SMART
transmembrane domain 736 758 N/A INTRINSIC
low complexity region 785 800 N/A INTRINSIC
low complexity region 883 898 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000088761
SMART Domains Protein: ENSMUSP00000086139
Gene: ENSMUSG00000040537

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Pep_M12B_propep 44 186 8.1e-27 PFAM
low complexity region 214 230 N/A INTRINSIC
Pfam:Reprolysin_5 235 405 1.2e-8 PFAM
Pfam:Reprolysin 237 436 1.1e-58 PFAM
Pfam:Reprolysin_3 261 379 3.6e-12 PFAM
DISIN 451 527 3.38e-31 SMART
ACR 528 669 3.05e-58 SMART
EGF 676 710 1.28e1 SMART
transmembrane domain 735 757 N/A INTRINSIC
low complexity region 789 808 N/A INTRINSIC
low complexity region 860 875 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115386
SMART Domains Protein: ENSMUSP00000111044
Gene: ENSMUSG00000040537

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Pep_M12B_propep 44 186 3.4e-27 PFAM
low complexity region 214 230 N/A INTRINSIC
Pfam:Reprolysin_5 235 405 5.1e-9 PFAM
Pfam:Reprolysin 237 436 5e-59 PFAM
Pfam:Reprolysin_3 261 379 1.6e-12 PFAM
DISIN 451 527 3.38e-31 SMART
ACR 528 669 3.05e-58 SMART
EGF 676 710 1.28e1 SMART
transmembrane domain 735 757 N/A INTRINSIC
low complexity region 850 870 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115388
SMART Domains Protein: ENSMUSP00000111046
Gene: ENSMUSG00000040537

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Pep_M12B_propep 44 186 8e-27 PFAM
low complexity region 214 230 N/A INTRINSIC
Pfam:Reprolysin_5 235 405 1.1e-8 PFAM
Pfam:Reprolysin 237 436 1.1e-58 PFAM
Pfam:Reprolysin_3 261 379 3.5e-12 PFAM
DISIN 451 527 3.38e-31 SMART
ACR 528 669 3.05e-58 SMART
EGF 676 710 1.28e1 SMART
transmembrane domain 735 757 N/A INTRINSIC
low complexity region 852 872 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000123168
SMART Domains Protein: ENSMUSP00000122758
Gene: ENSMUSG00000040537

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
low complexity region 123 143 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124121
SMART Domains Protein: ENSMUSP00000122652
Gene: ENSMUSG00000040537

DomainStartEndE-ValueType
Blast:ACR 2 52 5e-28 BLAST
EGF 59 93 1.28e1 SMART
transmembrane domain 118 140 N/A INTRINSIC
low complexity region 207 222 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126384
SMART Domains Protein: ENSMUSP00000118571
Gene: ENSMUSG00000040537

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
low complexity region 83 98 N/A INTRINSIC
low complexity region 181 196 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130315
SMART Domains Protein: ENSMUSP00000121156
Gene: ENSMUSG00000040537

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
low complexity region 150 170 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136524
SMART Domains Protein: ENSMUSP00000116422
Gene: ENSMUSG00000040537

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
low complexity region 152 172 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136808
SMART Domains Protein: ENSMUSP00000122426
Gene: ENSMUSG00000040537

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
low complexity region 83 98 N/A INTRINSIC
low complexity region 207 227 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139048
SMART Domains Protein: ENSMUSP00000116736
Gene: ENSMUSG00000040537

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
low complexity region 81 100 N/A INTRINSIC
low complexity region 186 206 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139841
SMART Domains Protein: ENSMUSP00000115775
Gene: ENSMUSG00000040537

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
low complexity region 144 164 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144241
SMART Domains Protein: ENSMUSP00000138353
Gene: ENSMUSG00000040537

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
low complexity region 75 94 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153427
SMART Domains Protein: ENSMUSP00000120995
Gene: ENSMUSG00000040537

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
low complexity region 75 94 N/A INTRINSIC
low complexity region 209 229 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153889
SMART Domains Protein: ENSMUSP00000123196
Gene: ENSMUSG00000040537

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
low complexity region 81 100 N/A INTRINSIC
low complexity region 152 167 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000154935
SMART Domains Protein: ENSMUSP00000119409
Gene: ENSMUSG00000040537

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
low complexity region 83 98 N/A INTRINSIC
low complexity region 225 245 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197700
SMART Domains Protein: ENSMUSP00000142580
Gene: ENSMUSG00000040537

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
low complexity region 129 145 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199853
SMART Domains Protein: ENSMUSP00000143097
Gene: ENSMUSG00000040537

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. The protein encoded by this gene is believed to lack metalloproteinase activity due to the lack of a critical catalytic motif. Mice lacking the encoded protein exhibit severe ataxia, hypomyelination and premature death. Alternative splicing results in multiple transcript variants encoding different isoforms, some of which may undergo similar processing. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygous mutant mice exhibit severe ataxia, die before weaning and have marked hypomyelination of the peripheral nerves. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank1 A G 8: 23,117,058 D1325G probably damaging Het
Asxl1 T C 2: 153,400,652 S1042P probably damaging Het
Bpifb1 C T 2: 154,202,729 H39Y possibly damaging Het
Capn13 C A 17: 73,315,305 M663I probably damaging Het
Clec2g A G 6: 128,979,437 E72G probably damaging Het
Col12a1 T A 9: 79,651,486 Y1899F probably damaging Het
Ctbp2 A G 7: 133,014,624 V194A probably benign Het
Cttnbp2 G T 6: 18,382,810 L1320I probably damaging Het
E2f2 T A 4: 136,192,826 L374* probably null Het
Echdc3 C T 2: 6,212,876 G29S probably benign Het
Ecm1 A G 3: 95,736,182 S269P probably damaging Het
Elmo2 G A 2: 165,291,744 P775S unknown Het
Eno3 T A 11: 70,659,167 probably null Het
Faf1 G A 4: 109,829,864 R267K probably benign Het
Fam162a G A 16: 36,049,937 probably benign Het
Fam178b T A 1: 36,564,451 D473V probably damaging Het
Fat2 G A 11: 55,282,330 T2519I probably damaging Het
Foxc2 A G 8: 121,118,095 Y494C probably damaging Het
Gcnt2 C A 13: 40,953,719 Q355K probably benign Het
Glg1 G T 8: 111,178,865 H595N probably benign Het
Gm9913 A T 2: 125,506,560 H97L unknown Het
Hbegf T A 18: 36,507,548 N152I possibly damaging Het
Hipk1 G A 3: 103,760,550 T567I probably damaging Het
Idh3a C T 9: 54,595,169 P78S probably damaging Het
Igsf10 A T 3: 59,319,340 M2304K possibly damaging Het
Inf2 A G 12: 112,606,994 T723A unknown Het
Itpr2 A T 6: 146,187,550 F2220Y probably benign Het
Kpnb1 C T 11: 97,169,173 R557Q probably damaging Het
Lefty1 A G 1: 180,936,760 D155G probably damaging Het
Lrp1 A G 10: 127,574,053 C1554R probably damaging Het
Lrrc10 A G 10: 117,045,757 D112G probably benign Het
Med12l A G 3: 59,076,720 E439G probably damaging Het
Ms4a7 A T 19: 11,324,504 F185Y probably benign Het
Mtmr6 T A 14: 60,289,652 M234K probably damaging Het
Myh7b C A 2: 155,617,778 probably null Het
Myo1d T C 11: 80,676,893 M254V possibly damaging Het
Nbas T C 12: 13,415,661 V1368A probably damaging Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Neb A G 2: 52,206,702 V4999A probably damaging Het
Npbwr1 G T 1: 5,916,708 Q196K probably benign Het
Nsd3 A T 8: 25,659,817 E339D possibly damaging Het
Olfr738 T C 14: 50,414,014 F157L probably damaging Het
Olfr776 A G 10: 129,261,068 S36G probably damaging Het
Olfr867 T C 9: 20,054,605 N168S probably damaging Het
Oog4 CAA CA 4: 143,437,452 probably null Het
Plxna1 C T 6: 89,331,900 V1199M probably damaging Het
Ppfibp2 T A 7: 107,716,666 M285K probably damaging Het
Ppip5k1 A G 2: 121,337,661 Y704H probably damaging Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Sbspon T C 1: 15,859,058 M170V probably benign Het
Scfd2 A C 5: 74,458,636 F440V probably benign Het
Slc22a19 T A 19: 7,710,937 D86V possibly damaging Het
Smg5 A G 3: 88,353,895 N685S possibly damaging Het
Spata46 A G 1: 170,311,764 R111G possibly damaging Het
Sry A T Y: 2,663,248 D137E possibly damaging Het
Tbkbp1 T C 11: 97,149,483 D35G probably damaging Het
Tcf20 A T 15: 82,851,565 V1895D possibly damaging Het
Tfap4 G T 16: 4,551,766 Q112K possibly damaging Het
Tmem2 C A 19: 21,798,116 T241K probably damaging Het
Trmt10c T A 16: 56,034,939 D111V probably benign Het
Unc80 T C 1: 66,649,722 I2415T probably benign Het
Vmn2r107 A T 17: 20,356,639 M300L probably benign Het
Vmn2r5 A T 3: 64,509,522 F72I probably benign Het
Vmn2r53 T A 7: 12,598,498 H408L probably benign Het
Zan C T 5: 137,463,540 V1126M unknown Het
Zfp493 A T 13: 67,779,695 probably benign Het
Zfp618 C A 4: 63,086,621 A86E probably benign Het
Other mutations in Adam22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01325:Adam22 APN 5 8127333 missense probably benign 0.44
IGL01368:Adam22 APN 5 8127411 missense probably damaging 1.00
IGL01406:Adam22 APN 5 8130212 nonsense probably null
IGL01463:Adam22 APN 5 8092790 missense probably damaging 1.00
IGL01691:Adam22 APN 5 8092742 missense probably damaging 1.00
IGL01798:Adam22 APN 5 8232604 splice site probably null
IGL01975:Adam22 APN 5 8167396 missense probably damaging 1.00
IGL02076:Adam22 APN 5 8136900 missense probably damaging 1.00
IGL02170:Adam22 APN 5 8134845 missense probably benign
IGL02189:Adam22 APN 5 8330029 missense possibly damaging 0.91
IGL02859:Adam22 APN 5 8167375 missense probably damaging 1.00
IGL03189:Adam22 APN 5 8111897 nonsense probably null
IGL03326:Adam22 APN 5 8127421 missense probably damaging 1.00
IGL03329:Adam22 APN 5 8149210 missense possibly damaging 0.48
IGL03354:Adam22 APN 5 8158890 missense possibly damaging 0.82
IGL03394:Adam22 APN 5 8167379 missense probably benign 0.00
IGL03047:Adam22 UTSW 5 8082220 missense probably damaging 1.00
R0445:Adam22 UTSW 5 8180591 intron probably benign
R0486:Adam22 UTSW 5 8330048 missense probably damaging 1.00
R0669:Adam22 UTSW 5 8143036 splice site probably benign
R0866:Adam22 UTSW 5 8082156 missense probably damaging 0.98
R1510:Adam22 UTSW 5 8152408 missense probably benign 0.06
R1562:Adam22 UTSW 5 8095007 missense probably damaging 1.00
R1640:Adam22 UTSW 5 8145689 missense probably damaging 1.00
R1903:Adam22 UTSW 5 8134525 missense probably damaging 1.00
R1939:Adam22 UTSW 5 8330015 missense probably damaging 1.00
R1998:Adam22 UTSW 5 8329995 missense probably damaging 1.00
R2012:Adam22 UTSW 5 8117634 missense probably damaging 1.00
R2214:Adam22 UTSW 5 8136805 critical splice donor site probably null
R2270:Adam22 UTSW 5 8121108 missense probably damaging 0.98
R2271:Adam22 UTSW 5 8121108 missense probably damaging 0.98
R2286:Adam22 UTSW 5 8145616 missense probably damaging 1.00
R2304:Adam22 UTSW 5 8092366 missense probably damaging 1.00
R2406:Adam22 UTSW 5 8180064 intron probably benign
R2656:Adam22 UTSW 5 8117696 missense probably damaging 1.00
R3106:Adam22 UTSW 5 8117583 splice site probably null
R3870:Adam22 UTSW 5 8132418 missense probably damaging 1.00
R3923:Adam22 UTSW 5 8130514 missense possibly damaging 0.68
R4092:Adam22 UTSW 5 8095004 missense probably damaging 1.00
R4180:Adam22 UTSW 5 8149218 missense probably damaging 1.00
R4247:Adam22 UTSW 5 8145626 missense probably benign
R4486:Adam22 UTSW 5 8180227 intron probably benign
R4629:Adam22 UTSW 5 8232663 missense possibly damaging 0.95
R4744:Adam22 UTSW 5 8078699 missense probably damaging 0.98
R4839:Adam22 UTSW 5 8136813 missense probably damaging 1.00
R5007:Adam22 UTSW 5 8167393 missense probably damaging 1.00
R5030:Adam22 UTSW 5 8179645 intron probably benign
R5061:Adam22 UTSW 5 8180238 intron probably benign
R5312:Adam22 UTSW 5 8090182 missense probably damaging 1.00
R5353:Adam22 UTSW 5 8090182 missense probably damaging 1.00
R5354:Adam22 UTSW 5 8090182 missense probably damaging 1.00
R5356:Adam22 UTSW 5 8090182 missense probably damaging 1.00
R5423:Adam22 UTSW 5 8090182 missense probably damaging 1.00
R5424:Adam22 UTSW 5 8090182 missense probably damaging 1.00
R5719:Adam22 UTSW 5 8367217 missense probably benign
R5763:Adam22 UTSW 5 8134544 missense probably damaging 1.00
R5768:Adam22 UTSW 5 8127426 missense probably benign 0.35
R5776:Adam22 UTSW 5 8127361 missense probably benign 0.26
R5839:Adam22 UTSW 5 8136861 missense probably damaging 0.99
R6314:Adam22 UTSW 5 8127365 nonsense probably null
R6520:Adam22 UTSW 5 8116635 missense probably damaging 0.98
R6798:Adam22 UTSW 5 8160784 missense probably damaging 1.00
R6924:Adam22 UTSW 5 8367322 missense possibly damaging 0.78
R6938:Adam22 UTSW 5 8146499 missense probably benign 0.01
R7317:Adam22 UTSW 5 8090202 missense probably benign
R7402:Adam22 UTSW 5 8095049 missense possibly damaging 0.95
R7431:Adam22 UTSW 5 8092818 missense probably damaging 1.00
R7527:Adam22 UTSW 5 8082239 missense possibly damaging 0.66
R7571:Adam22 UTSW 5 8082160 nonsense probably null
R7627:Adam22 UTSW 5 8367933 missense probably benign
R7714:Adam22 UTSW 5 8117587 critical splice donor site probably null
R7806:Adam22 UTSW 5 8092825 missense probably damaging 1.00
R7834:Adam22 UTSW 5 8130535 missense probably damaging 1.00
R7837:Adam22 UTSW 5 8149284 critical splice acceptor site probably null
R7979:Adam22 UTSW 5 8136804 critical splice donor site probably null
R8123:Adam22 UTSW 5 8092833 critical splice acceptor site probably null
R8511:Adam22 UTSW 5 8134558 missense probably damaging 0.98
X0067:Adam22 UTSW 5 8127329 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TGCAAGCGTTTTCCTTGCG -3'
(R):5'- AAAAGTACTGTAGTGTGACTGGTGC -3'

Sequencing Primer
(F):5'- CCTATGCACTCTTAGATAATAAGCAG -3'
(R):5'- AGTGTGACTGGTGCCTCTCTC -3'
Posted On2020-03-19