Incidental Mutation 'R7747:Sfswap'
ID628409
Institutional Source Beutler Lab
Gene Symbol Sfswap
Ensembl Gene ENSMUSG00000029439
Gene Namesplicing factor SWAP
SynonymsSfrs8, 6330437E22Rik, 1190005N23Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7747 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location129501221-129571384 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) G to T at 129550593 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000062413 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053737] [ENSMUST00000196698]
Predicted Effect probably null
Transcript: ENSMUST00000053737
SMART Domains Protein: ENSMUSP00000062413
Gene: ENSMUSG00000029439

DomainStartEndE-ValueType
low complexity region 22 30 N/A INTRINSIC
DRY_EERY 33 157 1.15e-57 SMART
low complexity region 160 170 N/A INTRINSIC
low complexity region 174 186 N/A INTRINSIC
SWAP 209 262 3.94e-19 SMART
low complexity region 286 293 N/A INTRINSIC
low complexity region 333 352 N/A INTRINSIC
low complexity region 397 441 N/A INTRINSIC
SWAP 456 507 9.55e-18 SMART
low complexity region 513 532 N/A INTRINSIC
low complexity region 548 562 N/A INTRINSIC
low complexity region 598 607 N/A INTRINSIC
coiled coil region 631 686 N/A INTRINSIC
low complexity region 741 788 N/A INTRINSIC
low complexity region 797 821 N/A INTRINSIC
low complexity region 840 865 N/A INTRINSIC
low complexity region 871 888 N/A INTRINSIC
low complexity region 889 905 N/A INTRINSIC
low complexity region 909 920 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196698
SMART Domains Protein: ENSMUSP00000142464
Gene: ENSMUSG00000029439

DomainStartEndE-ValueType
low complexity region 22 30 N/A INTRINSIC
DRY_EERY 33 121 1.8e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199215
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (89/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a human homolog of Drosophila splicing regulatory protein. This gene autoregulates its expression by control of splicing of its first two introns. In addition, it also regulates the splicing of fibronectin and CD45 genes. Two transcript variants encoding different isoforms have been identified. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit a wobbly phenotype with inner ear defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010109A12Rik G A 5: 93,206,557 probably null Het
2410004P03Rik C T 12: 17,007,148 S116N probably damaging Het
3425401B19Rik T C 14: 32,663,069 D313G possibly damaging Het
AA986860 A G 1: 130,743,547 E502G possibly damaging Het
Adamts20 T A 15: 94,291,587 K1462* probably null Het
Adgrg6 A C 10: 14,450,577 probably null Het
Ankrd13d G A 19: 4,280,985 H165Y probably damaging Het
Arap3 T C 18: 37,988,888 probably null Het
Arhgap33 A G 7: 30,524,135 V823A probably damaging Het
Aup1 C A 6: 83,054,795 P34T unknown Het
Bcl2l2 C T 14: 54,884,379 probably benign Het
Bicc1 T C 10: 70,946,993 T515A probably benign Het
Ccdc73 A C 2: 104,929,556 K106Q probably damaging Het
Celsr3 G A 9: 108,829,978 R1220Q possibly damaging Het
Cep290 C T 10: 100,558,176 Q2082* probably null Het
Cercam A G 2: 29,871,286 D104G probably benign Het
Champ1 A G 8: 13,879,990 H716R probably damaging Het
Cntrl A T 2: 35,116,798 I159F probably damaging Het
Col11a1 T C 3: 114,102,572 I507T unknown Het
Cped1 T C 6: 22,143,974 I573T probably damaging Het
Crot C T 5: 8,968,869 probably null Het
D1Pas1 T A 1: 186,968,677 S268T probably benign Het
Erich6 A G 3: 58,618,928 V551A probably damaging Het
Fbxo32 T C 15: 58,191,361 N192S probably damaging Het
Fgd6 T C 10: 94,044,916 V544A probably damaging Het
Fnbp1 C T 2: 31,036,147 G552E probably damaging Het
Gjb5 A T 4: 127,356,162 V63D probably damaging Het
Gm10053 T C 19: 24,876,039 I96T probably benign Het
Gm11639 T G 11: 104,842,603 I2011S probably damaging Het
Gm38119 T C 3: 92,738,021 S89G unknown Het
Gm884 A T 11: 103,614,255 S2296T probably damaging Het
Gpn2 A G 4: 133,586,045 I183V probably benign Het
Greb1 C T 12: 16,674,795 V1793M probably benign Het
H2-Q7 A G 17: 35,440,061 I163V probably benign Het
Hrh2 T C 13: 54,214,530 V175A possibly damaging Het
Hsd3b3 C T 3: 98,743,898 V79I possibly damaging Het
Itgb7 T C 15: 102,216,604 I727M possibly damaging Het
Kcnj16 T A 11: 111,024,743 F77Y probably damaging Het
Lilra6 T A 7: 3,912,996 Q288L probably benign Het
Malrd1 G A 2: 16,074,835 V1788M unknown Het
Mau2 T C 8: 70,026,723 I349V possibly damaging Het
Mbnl3 C T X: 51,130,334 R181H probably damaging Het
Mfsd6 T C 1: 52,676,547 T524A probably benign Het
Mical2 G T 7: 112,333,839 R740L probably benign Het
Mknk1 G A 4: 115,878,072 C379Y possibly damaging Het
Mta3 A T 17: 83,791,736 K410* probably null Het
Myb A C 10: 21,156,425 I19S possibly damaging Het
Ncor2 A G 5: 125,027,038 F996S Het
Nlrp1a T C 11: 71,123,408 M339V possibly damaging Het
Olfr136 C T 17: 38,335,394 P79L probably benign Het
Olfr689 A G 7: 105,314,447 K148E probably damaging Het
Pcdhga5 C T 18: 37,696,782 T761I possibly damaging Het
Pcmtd2 T C 2: 181,851,659 L219P possibly damaging Het
Pfdn1 C T 18: 36,432,305 probably null Het
Pkn3 G A 2: 30,090,584 C829Y probably benign Het
Pld1 T C 3: 28,087,189 S634P possibly damaging Het
Pofut2 T G 10: 77,262,470 V139G possibly damaging Het
Prdm12 C A 2: 31,653,871 probably null Het
Prkar2b C A 12: 32,060,938 A49S probably benign Het
Prmt1 A T 7: 44,984,136 probably null Het
Rab39 A T 9: 53,686,400 D188E probably benign Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Scgb1b19 A G 7: 33,287,498 I25V probably benign Het
Scn9a A T 2: 66,484,298 I1692N probably damaging Het
Sdk1 G T 5: 142,084,491 G1137V probably damaging Het
Sec16b A G 1: 157,565,472 T950A possibly damaging Het
Senp2 G T 16: 22,038,622 R398L probably damaging Het
Sh3rf1 A G 8: 61,353,753 T362A probably damaging Het
Slc17a1 A T 13: 23,888,052 I418F probably benign Het
Slc1a4 A T 11: 20,308,587 M284K probably damaging Het
Slc5a2 A T 7: 128,266,395 probably null Het
Slco5a1 A G 1: 12,990,122 V125A probably benign Het
Smu1 A G 4: 40,748,600 V230A probably benign Het
Sp4 A G 12: 118,254,404 probably null Het
Stbd1 A G 5: 92,605,557 K302R probably damaging Het
Stx2 A T 5: 128,986,417 V268D probably benign Het
Tbc1d9b G A 11: 50,161,620 A885T probably benign Het
Tbce T A 13: 14,006,478 D267V possibly damaging Het
Tert T C 13: 73,627,606 Y159H probably damaging Het
Thbs2 T A 17: 14,670,039 I1102F possibly damaging Het
Tmprss7 G C 16: 45,683,510 A183G probably benign Het
Top3b C A 16: 16,887,721 P450Q probably benign Het
Trpm6 A T 19: 18,750,045 probably null Het
Ube4a T C 9: 44,925,973 D988G probably damaging Het
Vmn1r158 A T 7: 22,790,300 S161R probably benign Het
Vps41 T C 13: 18,841,252 probably null Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 probably benign Het
Zfp617 T A 8: 71,928,189 probably null Het
Zfp808 C T 13: 62,171,505 H183Y probably benign Het
Zfy1 A T Y: 725,496 C756* probably null Het
Zswim2 A T 2: 83,915,607 Y496N probably damaging Het
Other mutations in Sfswap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00740:Sfswap APN 5 129513233 missense probably damaging 1.00
IGL02064:Sfswap APN 5 129560796 missense probably benign 0.17
IGL02083:Sfswap APN 5 129539791 missense probably benign
IGL02378:Sfswap APN 5 129539604 missense probably damaging 1.00
FR4340:Sfswap UTSW 5 129569751 unclassified probably benign
FR4342:Sfswap UTSW 5 129569757 unclassified probably benign
FR4449:Sfswap UTSW 5 129569748 unclassified probably benign
FR4449:Sfswap UTSW 5 129569749 unclassified probably benign
FR4548:Sfswap UTSW 5 129569749 unclassified probably benign
FR4548:Sfswap UTSW 5 129569755 unclassified probably benign
FR4737:Sfswap UTSW 5 129569756 unclassified probably benign
FR4976:Sfswap UTSW 5 129569751 unclassified probably benign
I1329:Sfswap UTSW 5 129507137 unclassified probably benign
P0033:Sfswap UTSW 5 129539755 missense possibly damaging 0.60
R0184:Sfswap UTSW 5 129507189 missense probably damaging 0.97
R0233:Sfswap UTSW 5 129554543 missense possibly damaging 0.82
R0233:Sfswap UTSW 5 129554543 missense possibly damaging 0.82
R0414:Sfswap UTSW 5 129504051 missense possibly damaging 0.83
R0415:Sfswap UTSW 5 129504126 missense probably damaging 1.00
R0570:Sfswap UTSW 5 129503978 splice site probably benign
R1018:Sfswap UTSW 5 129554576 missense possibly damaging 0.91
R1173:Sfswap UTSW 5 129507143 critical splice acceptor site probably null
R1298:Sfswap UTSW 5 129541378 missense probably benign 0.14
R1723:Sfswap UTSW 5 129539694 missense probably benign
R1783:Sfswap UTSW 5 129513240 missense possibly damaging 0.92
R1828:Sfswap UTSW 5 129513084 missense probably damaging 1.00
R1879:Sfswap UTSW 5 129541328 missense probably benign 0.01
R2078:Sfswap UTSW 5 129516107 missense possibly damaging 0.81
R2349:Sfswap UTSW 5 129569738 missense possibly damaging 0.87
R3757:Sfswap UTSW 5 129513234 missense probably damaging 1.00
R4093:Sfswap UTSW 5 129560741 missense possibly damaging 0.85
R4094:Sfswap UTSW 5 129560741 missense possibly damaging 0.85
R4095:Sfswap UTSW 5 129560741 missense possibly damaging 0.85
R4785:Sfswap UTSW 5 129513083 missense probably damaging 1.00
R5139:Sfswap UTSW 5 129571009 missense possibly damaging 0.73
R5355:Sfswap UTSW 5 129539746 missense probably benign 0.09
R5481:Sfswap UTSW 5 129514818 missense probably damaging 0.98
R5600:Sfswap UTSW 5 129513158 missense probably damaging 1.00
R5686:Sfswap UTSW 5 129514818 missense probably damaging 0.98
R5906:Sfswap UTSW 5 129542043 missense probably benign 0.22
R6332:Sfswap UTSW 5 129571041 missense possibly damaging 0.91
R6738:Sfswap UTSW 5 129541441 missense probably damaging 0.98
R6743:Sfswap UTSW 5 129550819 nonsense probably null
R7371:Sfswap UTSW 5 129543241 missense probably benign 0.01
RF003:Sfswap UTSW 5 129569764 unclassified probably benign
RF042:Sfswap UTSW 5 129569743 unclassified probably benign
RF049:Sfswap UTSW 5 129569744 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CTCAGACACTTGCCACTTGG -3'
(R):5'- CTTTTACGTTCAGCCTGAAGC -3'

Sequencing Primer
(F):5'- ACACTTGCCACTTGGAGTGTG -3'
(R):5'- GCCTGAAGCTGCTTCTCC -3'
Posted On2020-03-19