Incidental Mutation 'R7747:Arap3'
ID 628414
Institutional Source Beutler Lab
Gene Symbol Arap3
Ensembl Gene ENSMUSG00000024451
Gene Name ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3
Synonyms Centd3, E030006K04Rik, DRAG1
MMRRC Submission 045803-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.814) question?
Stock # R7747 (G1)
Quality Score 142.008
Status Validated
Chromosome 18
Chromosomal Location 38105681-38132022 bp(-) (GRCm39)
Type of Mutation splice site (171 bp from exon)
DNA Base Change (assembly) T to C at 38121941 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000035662 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042944]
AlphaFold Q8R5G7
Predicted Effect probably null
Transcript: ENSMUST00000042944
SMART Domains Protein: ENSMUSP00000035662
Gene: ENSMUSG00000024451

DomainStartEndE-ValueType
SAM 1 68 1.5e-7 SMART
low complexity region 81 98 N/A INTRINSIC
low complexity region 134 142 N/A INTRINSIC
PH 283 376 3.4e-16 SMART
PH 390 480 1.61e-8 SMART
ArfGap 484 606 1.44e-25 SMART
low complexity region 642 661 N/A INTRINSIC
PH 671 785 2.86e1 SMART
PH 795 901 6.87e-3 SMART
RhoGAP 913 1089 2.11e-47 SMART
Pfam:RA 1113 1206 6.2e-16 PFAM
PH 1220 1323 3.46e-8 SMART
low complexity region 1388 1407 N/A INTRINSIC
low complexity region 1457 1469 N/A INTRINSIC
low complexity region 1475 1486 N/A INTRINSIC
low complexity region 1494 1529 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (89/89)
MGI Phenotype FUNCTION: This gene encodes a phosphoinositide binding protein containing ARF-GAP, RHO-GAP, RAS-associating, and pleckstrin homology domains. The ARF-GAP and RHO-GAP domains cooperate in mediating rearrangements in the cell cytoskeleton and cell shape. It is a specific PtdIns(3,4,5)P3/PtdIns(3,4)P2-stimulated Arf6-GAP protein. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele die around E11 exhibiting pallor, embryonic growth arrest, yolk sac and placental abnormalities, and an endothelial cell-autonomous defect in sprouting angiogenesis. Knock-in mice homozygous for a point mutation display similar angiogenesis defects. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted(5)

Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010109A12Rik G A 5: 93,354,416 (GRCm39) probably null Het
2410004P03Rik C T 12: 17,057,149 (GRCm39) S116N probably damaging Het
3425401B19Rik T C 14: 32,385,026 (GRCm39) D313G possibly damaging Het
AA986860 A G 1: 130,671,284 (GRCm39) E502G possibly damaging Het
Adamts20 T A 15: 94,189,468 (GRCm39) K1462* probably null Het
Adgrg6 A C 10: 14,326,321 (GRCm39) probably null Het
Ankrd13d G A 19: 4,331,013 (GRCm39) H165Y probably damaging Het
Arhgap33 A G 7: 30,223,560 (GRCm39) V823A probably damaging Het
Aup1 C A 6: 83,031,776 (GRCm39) P34T unknown Het
Bcl2l2 C T 14: 55,121,836 (GRCm39) probably benign Het
Bicc1 T C 10: 70,782,823 (GRCm39) T515A probably benign Het
Ccdc73 A C 2: 104,759,901 (GRCm39) K106Q probably damaging Het
Celsr3 G A 9: 108,707,177 (GRCm39) R1220Q possibly damaging Het
Cep290 C T 10: 100,394,038 (GRCm39) Q2082* probably null Het
Cercam A G 2: 29,761,298 (GRCm39) D104G probably benign Het
Champ1 A G 8: 13,929,990 (GRCm39) H716R probably damaging Het
Cntrl A T 2: 35,006,810 (GRCm39) I159F probably damaging Het
Col11a1 T C 3: 113,896,221 (GRCm39) I507T unknown Het
Cped1 T C 6: 22,143,973 (GRCm39) I573T probably damaging Het
Crot C T 5: 9,018,869 (GRCm39) probably null Het
D1Pas1 T A 1: 186,700,874 (GRCm39) S268T probably benign Het
Efcab3 T G 11: 104,733,429 (GRCm39) I2011S probably damaging Het
Erich6 A G 3: 58,526,349 (GRCm39) V551A probably damaging Het
Fbxo32 T C 15: 58,054,757 (GRCm39) N192S probably damaging Het
Fgd6 T C 10: 93,880,778 (GRCm39) V544A probably damaging Het
Fnbp1 C T 2: 30,926,159 (GRCm39) G552E probably damaging Het
Gjb5 A T 4: 127,249,955 (GRCm39) V63D probably damaging Het
Gm10053 T C 19: 24,853,403 (GRCm39) I96T probably benign Het
Gm38119 T C 3: 92,645,328 (GRCm39) S89G unknown Het
Gpn2 A G 4: 133,313,356 (GRCm39) I183V probably benign Het
Greb1 C T 12: 16,724,796 (GRCm39) V1793M probably benign Het
H2-Q7 A G 17: 35,659,037 (GRCm39) I163V probably benign Het
Hrh2 T C 13: 54,368,549 (GRCm39) V175A possibly damaging Het
Hsd3b3 C T 3: 98,651,214 (GRCm39) V79I possibly damaging Het
Itgb7 T C 15: 102,125,039 (GRCm39) I727M possibly damaging Het
Kcnj16 T A 11: 110,915,569 (GRCm39) F77Y probably damaging Het
Lilra6 T A 7: 3,915,995 (GRCm39) Q288L probably benign Het
Lrrc37 A T 11: 103,505,081 (GRCm39) S2296T probably damaging Het
Malrd1 G A 2: 16,079,646 (GRCm39) V1788M unknown Het
Mau2 T C 8: 70,479,373 (GRCm39) I349V possibly damaging Het
Mbnl3 C T X: 50,219,211 (GRCm39) R181H probably damaging Het
Mfsd6 T C 1: 52,715,706 (GRCm39) T524A probably benign Het
Mical2 G T 7: 111,933,046 (GRCm39) R740L probably benign Het
Mknk1 G A 4: 115,735,269 (GRCm39) C379Y possibly damaging Het
Mta3 A T 17: 84,099,165 (GRCm39) K410* probably null Het
Myb A C 10: 21,032,324 (GRCm39) I19S possibly damaging Het
Ncor2 A G 5: 125,104,102 (GRCm39) F996S Het
Nlrp1a T C 11: 71,014,234 (GRCm39) M339V possibly damaging Het
Or2n1d C T 17: 38,646,285 (GRCm39) P79L probably benign Het
Or56b35 A G 7: 104,963,654 (GRCm39) K148E probably damaging Het
Pcdhga5 C T 18: 37,829,835 (GRCm39) T761I possibly damaging Het
Pcmtd2 T C 2: 181,493,452 (GRCm39) L219P possibly damaging Het
Pfdn1 C T 18: 36,565,358 (GRCm39) probably null Het
Pkn3 G A 2: 29,980,596 (GRCm39) C829Y probably benign Het
Pld1 T C 3: 28,141,338 (GRCm39) S634P possibly damaging Het
Pofut2 T G 10: 77,098,304 (GRCm39) V139G possibly damaging Het
Prdm12 C A 2: 31,543,883 (GRCm39) probably null Het
Prkar2b C A 12: 32,110,937 (GRCm39) A49S probably benign Het
Prmt1 A T 7: 44,633,560 (GRCm39) probably null Het
Rab39 A T 9: 53,597,700 (GRCm39) D188E probably benign Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Scgb1b19 A G 7: 32,986,923 (GRCm39) I25V probably benign Het
Scn9a A T 2: 66,314,642 (GRCm39) I1692N probably damaging Het
Sdk1 G T 5: 142,070,246 (GRCm39) G1137V probably damaging Het
Sec16b A G 1: 157,393,042 (GRCm39) T950A possibly damaging Het
Senp2 G T 16: 21,857,372 (GRCm39) R398L probably damaging Het
Sfswap G T 5: 129,627,657 (GRCm39) probably null Het
Sh3rf1 A G 8: 61,806,787 (GRCm39) T362A probably damaging Het
Slc17a1 A T 13: 24,072,035 (GRCm39) I418F probably benign Het
Slc1a4 A T 11: 20,258,587 (GRCm39) M284K probably damaging Het
Slc5a2 A T 7: 127,865,567 (GRCm39) probably null Het
Slco5a1 A G 1: 13,060,346 (GRCm39) V125A probably benign Het
Smu1 A G 4: 40,748,600 (GRCm39) V230A probably benign Het
Sp4 A G 12: 118,218,139 (GRCm39) probably null Het
Stbd1 A G 5: 92,753,416 (GRCm39) K302R probably damaging Het
Stx2 A T 5: 129,063,481 (GRCm39) V268D probably benign Het
Tbc1d9b G A 11: 50,052,447 (GRCm39) A885T probably benign Het
Tbce T A 13: 14,181,063 (GRCm39) D267V possibly damaging Het
Tert T C 13: 73,775,725 (GRCm39) Y159H probably damaging Het
Thbs2 T A 17: 14,890,301 (GRCm39) I1102F possibly damaging Het
Tmprss7 G C 16: 45,503,873 (GRCm39) A183G probably benign Het
Top3b C A 16: 16,705,585 (GRCm39) P450Q probably benign Het
Trpm6 A T 19: 18,727,409 (GRCm39) probably null Het
Ube4a T C 9: 44,837,271 (GRCm39) D988G probably damaging Het
Vmn1r158 A T 7: 22,489,725 (GRCm39) S161R probably benign Het
Vps41 T C 13: 19,025,422 (GRCm39) probably null Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,706,067 (GRCm39) probably benign Het
Zfp617 T A 8: 72,682,033 (GRCm39) probably null Het
Zfp808 C T 13: 62,319,319 (GRCm39) H183Y probably benign Het
Zfy1 A T Y: 725,496 (GRCm39) C756* probably null Het
Zswim2 A T 2: 83,745,951 (GRCm39) Y496N probably damaging Het
Other mutations in Arap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Arap3 APN 18 38,108,979 (GRCm39) missense probably damaging 1.00
IGL01145:Arap3 APN 18 38,122,232 (GRCm39) missense probably benign
IGL01154:Arap3 APN 18 38,129,787 (GRCm39) missense probably benign 0.28
IGL01305:Arap3 APN 18 38,124,380 (GRCm39) critical splice donor site probably null
IGL01542:Arap3 APN 18 38,123,889 (GRCm39) missense probably damaging 0.98
IGL01543:Arap3 APN 18 38,123,889 (GRCm39) missense probably damaging 0.98
IGL01544:Arap3 APN 18 38,123,889 (GRCm39) missense probably damaging 0.98
IGL01545:Arap3 APN 18 38,123,889 (GRCm39) missense probably damaging 0.98
IGL01677:Arap3 APN 18 38,129,700 (GRCm39) missense probably benign
IGL01925:Arap3 APN 18 38,117,299 (GRCm39) missense probably benign 0.21
IGL01933:Arap3 APN 18 38,111,506 (GRCm39) missense possibly damaging 0.65
IGL02048:Arap3 APN 18 38,130,032 (GRCm39) missense possibly damaging 0.56
IGL02064:Arap3 APN 18 38,124,754 (GRCm39) missense probably damaging 1.00
IGL02207:Arap3 APN 18 38,120,906 (GRCm39) missense probably benign 0.00
IGL02376:Arap3 APN 18 38,111,506 (GRCm39) missense possibly damaging 0.95
IGL02531:Arap3 APN 18 38,122,804 (GRCm39) missense probably damaging 0.99
IGL02568:Arap3 APN 18 38,129,711 (GRCm39) missense probably benign 0.32
IGL02640:Arap3 APN 18 38,120,855 (GRCm39) missense possibly damaging 0.71
IGL02658:Arap3 APN 18 38,124,047 (GRCm39) missense probably benign 0.09
IGL03090:Arap3 APN 18 38,122,165 (GRCm39) missense probably benign 0.00
IGL03352:Arap3 APN 18 38,114,355 (GRCm39) splice site probably benign
ANU22:Arap3 UTSW 18 38,124,380 (GRCm39) critical splice donor site probably null
P0016:Arap3 UTSW 18 38,117,401 (GRCm39) missense probably benign 0.00
PIT4260001:Arap3 UTSW 18 38,129,948 (GRCm39) missense probably benign 0.08
R0066:Arap3 UTSW 18 38,129,760 (GRCm39) missense probably benign 0.01
R0324:Arap3 UTSW 18 38,106,278 (GRCm39) missense possibly damaging 0.93
R0562:Arap3 UTSW 18 38,108,593 (GRCm39) missense probably damaging 1.00
R1289:Arap3 UTSW 18 38,115,026 (GRCm39) missense possibly damaging 0.95
R1346:Arap3 UTSW 18 38,108,971 (GRCm39) missense probably damaging 1.00
R1419:Arap3 UTSW 18 38,111,485 (GRCm39) missense possibly damaging 0.51
R1470:Arap3 UTSW 18 38,122,249 (GRCm39) critical splice acceptor site probably null
R1470:Arap3 UTSW 18 38,122,249 (GRCm39) critical splice acceptor site probably null
R1537:Arap3 UTSW 18 38,122,737 (GRCm39) critical splice donor site probably null
R1644:Arap3 UTSW 18 38,117,298 (GRCm39) missense probably damaging 1.00
R1731:Arap3 UTSW 18 38,122,965 (GRCm39) missense probably benign 0.01
R1758:Arap3 UTSW 18 38,122,965 (GRCm39) missense probably benign 0.01
R1843:Arap3 UTSW 18 38,108,636 (GRCm39) missense probably damaging 1.00
R1907:Arap3 UTSW 18 38,129,724 (GRCm39) missense probably benign 0.28
R1954:Arap3 UTSW 18 38,115,055 (GRCm39) missense probably damaging 1.00
R2124:Arap3 UTSW 18 38,106,403 (GRCm39) missense probably damaging 0.98
R2135:Arap3 UTSW 18 38,107,509 (GRCm39) missense probably damaging 1.00
R2172:Arap3 UTSW 18 38,123,613 (GRCm39) missense probably damaging 1.00
R2418:Arap3 UTSW 18 38,122,997 (GRCm39) missense probably damaging 1.00
R2419:Arap3 UTSW 18 38,122,997 (GRCm39) missense probably damaging 1.00
R2907:Arap3 UTSW 18 38,123,580 (GRCm39) missense possibly damaging 0.88
R4425:Arap3 UTSW 18 38,111,653 (GRCm39) missense probably damaging 1.00
R4669:Arap3 UTSW 18 38,129,307 (GRCm39) missense probably benign 0.08
R4734:Arap3 UTSW 18 38,129,328 (GRCm39) missense probably benign 0.00
R4815:Arap3 UTSW 18 38,106,296 (GRCm39) missense probably benign
R5328:Arap3 UTSW 18 38,124,740 (GRCm39) missense possibly damaging 0.92
R5350:Arap3 UTSW 18 38,115,088 (GRCm39) missense probably damaging 1.00
R5466:Arap3 UTSW 18 38,129,789 (GRCm39) missense probably benign 0.00
R5482:Arap3 UTSW 18 38,107,727 (GRCm39) missense possibly damaging 0.95
R5572:Arap3 UTSW 18 38,124,119 (GRCm39) missense probably damaging 1.00
R5779:Arap3 UTSW 18 38,117,418 (GRCm39) missense probably damaging 1.00
R6053:Arap3 UTSW 18 38,123,824 (GRCm39) missense probably damaging 0.98
R6144:Arap3 UTSW 18 38,118,486 (GRCm39) missense probably damaging 0.98
R6166:Arap3 UTSW 18 38,107,423 (GRCm39) missense probably damaging 1.00
R6248:Arap3 UTSW 18 38,124,407 (GRCm39) missense probably benign 0.09
R6266:Arap3 UTSW 18 38,123,844 (GRCm39) missense probably damaging 0.98
R6385:Arap3 UTSW 18 38,130,084 (GRCm39) nonsense probably null
R6694:Arap3 UTSW 18 38,124,590 (GRCm39) critical splice donor site probably null
R6856:Arap3 UTSW 18 38,112,916 (GRCm39) missense possibly damaging 0.95
R7073:Arap3 UTSW 18 38,107,495 (GRCm39) nonsense probably null
R7297:Arap3 UTSW 18 38,106,616 (GRCm39) missense possibly damaging 0.81
R7352:Arap3 UTSW 18 38,106,331 (GRCm39) missense probably benign 0.00
R7652:Arap3 UTSW 18 38,111,505 (GRCm39) missense probably damaging 0.99
R7726:Arap3 UTSW 18 38,122,520 (GRCm39) missense probably damaging 0.99
R7944:Arap3 UTSW 18 38,122,232 (GRCm39) missense probably benign
R8152:Arap3 UTSW 18 38,124,410 (GRCm39) missense possibly damaging 0.61
R8338:Arap3 UTSW 18 38,106,683 (GRCm39) missense probably damaging 0.99
R8549:Arap3 UTSW 18 38,106,365 (GRCm39) missense probably benign 0.17
R8793:Arap3 UTSW 18 38,107,492 (GRCm39) missense probably benign 0.04
R8876:Arap3 UTSW 18 38,130,077 (GRCm39) missense possibly damaging 0.67
R9142:Arap3 UTSW 18 38,112,934 (GRCm39) missense possibly damaging 0.80
R9237:Arap3 UTSW 18 38,112,934 (GRCm39) missense possibly damaging 0.80
R9583:Arap3 UTSW 18 38,109,096 (GRCm39) missense probably damaging 0.97
R9696:Arap3 UTSW 18 38,112,905 (GRCm39) missense probably damaging 1.00
X0011:Arap3 UTSW 18 38,107,154 (GRCm39) critical splice donor site probably null
X0026:Arap3 UTSW 18 38,118,364 (GRCm39) critical splice donor site probably null
X0027:Arap3 UTSW 18 38,106,538 (GRCm39) splice site probably null
X0066:Arap3 UTSW 18 38,124,699 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CTTCAGAGCATGGTCATCGG -3'
(R):5'- CTCAATGGCAGCTTGCTTAG -3'

Sequencing Primer
(F):5'- CAGAGCATGGTCATCGGTTAAATGTC -3'
(R):5'- GCTTAGCCTTCTACCTTCAGG -3'
Posted On 2020-03-19