Incidental Mutation 'R7744:Setd7'
ID628422
Institutional Source Beutler Lab
Gene Symbol Setd7
Ensembl Gene ENSMUSG00000037111
Gene NameSET domain containing (lysine methyltransferase) 7
SynonymsKMT7, Set7, 1600028F23Rik, Set7/9
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7744 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location51515319-51560879 bp(-) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) C to T at 51526840 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000043492 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037141]
Predicted Effect probably null
Transcript: ENSMUST00000037141
SMART Domains Protein: ENSMUSP00000043492
Gene: ENSMUSG00000037111

DomainStartEndE-ValueType
Pfam:MORN 13 35 9e-3 PFAM
Pfam:MORN 36 58 1.7e-6 PFAM
Pfam:MORN 60 81 1.6e-6 PFAM
Pfam:MORN 106 128 2.2e-6 PFAM
SET 214 342 2.35e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (55/55)
MGI Phenotype PHENOTYPE: Homozygotes for a knock-out allele exhibit partial prenatal lethality and failure of mouse embryonic fibroblasts and spleen cells to arrest after doxorubicin treatment. Homozygotes for a different knock-out allele show resistance to bleomycin- or adenovirus-TGFbeta-induced pulmonary fibrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,290,421 N761K possibly damaging Het
Abi2 A G 1: 60,437,203 I145V probably benign Het
Ampd2 C A 3: 108,080,116 V134L probably benign Het
Atf7ip2 T A 16: 10,241,658 V354E possibly damaging Het
Bglap T C 3: 88,383,651 Y91C probably damaging Het
Cacna1e A T 1: 154,465,792 S1219T probably damaging Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cd177 A G 7: 24,750,375 C562R probably damaging Het
Cfap57 C T 4: 118,614,931 V84I not run Het
Chd7 T A 4: 8,862,485 probably null Het
Dyrk3 A G 1: 131,129,806 V210A probably damaging Het
Eif3c C A 7: 126,558,894 G297W probably damaging Het
Eml1 A G 12: 108,516,604 H494R probably benign Het
Enpp2 A T 15: 54,901,233 probably null Het
Fbxw21 C A 9: 109,157,652 C53F possibly damaging Het
Fndc3a C A 14: 72,561,716 G609V possibly damaging Het
Grid1 A G 14: 35,450,079 D514G probably damaging Het
Gxylt2 T C 6: 100,783,317 V271A probably damaging Het
Hes1 A G 16: 30,066,179 K74R probably damaging Het
Igsf9 A G 1: 172,492,185 N349S probably benign Het
Isx T A 8: 74,873,657 I6N possibly damaging Het
Kcnb1 A T 2: 167,188,331 F98Y probably damaging Het
Kif1b G C 4: 149,237,075 T1129R possibly damaging Het
Klra10 T A 6: 130,272,761 probably null Het
Mcm10 A T 2: 4,991,442 L870Q probably damaging Het
Mettl16 T A 11: 74,803,003 I280K probably benign Het
Mre11a G A 9: 14,809,832 R349Q possibly damaging Het
Mrpl10 C T 11: 97,044,576 T34I probably damaging Het
Muc16 T A 9: 18,585,096 probably null Het
Myt1l T C 12: 29,827,549 C400R unknown Het
Nbr1 C T 11: 101,569,384 T402M probably damaging Het
Ndufs1 A G 1: 63,160,940 M271T possibly damaging Het
Olfr1209 C T 2: 88,909,659 V245I possibly damaging Het
Olfr1494 A G 19: 13,750,055 *316W probably null Het
Olfr562-ps1 G T 7: 102,782,390 V305L probably benign Het
Palm2 T C 4: 57,709,519 S155P probably damaging Het
Pced1a C T 2: 130,422,052 D227N probably damaging Het
Phf21b A G 15: 84,804,869 I152T probably damaging Het
Pla2g4a A G 1: 149,861,102 V430A probably benign Het
Plbd1 T C 6: 136,617,246 E335G probably benign Het
Plce1 G A 19: 38,620,455 V403M possibly damaging Het
Pnpla6 T A 8: 3,531,677 N642K probably benign Het
Ptprb T C 10: 116,277,484 I123T probably benign Het
Rab3il1 T A 19: 10,028,277 probably null Het
Ranbp3 C T 17: 56,708,219 T307M possibly damaging Het
Rasgrp2 T C 19: 6,405,001 S254P probably damaging Het
Rgl3 T C 9: 21,987,570 K191R probably benign Het
Rnf223 G A 4: 156,132,525 R119H probably benign Het
Sapcd2 C T 2: 25,373,496 P217S unknown Het
Sh3bp1 A C 15: 78,910,009 T526P possibly damaging Het
Slc17a4 C A 13: 23,901,784 W382L probably benign Het
Slc26a3 A T 12: 31,463,465 probably null Het
Tmem129 A G 5: 33,654,388 L356P probably damaging Het
Trib1 T A 15: 59,654,663 Y361N probably benign Het
Xirp1 T A 9: 120,016,846 R990S possibly damaging Het
Zfp950 A C 19: 61,127,572 probably null Het
Other mutations in Setd7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Setd7 APN 3 51550308 missense probably benign 0.00
IGL00940:Setd7 APN 3 51533038 missense probably damaging 1.00
IGL00943:Setd7 APN 3 51533038 missense probably damaging 1.00
IGL00944:Setd7 APN 3 51533038 missense probably damaging 1.00
IGL01466:Setd7 APN 3 51521309 makesense probably null
IGL01810:Setd7 APN 3 51532967 splice site probably benign
IGL01884:Setd7 APN 3 51542711 missense possibly damaging 0.71
IGL02117:Setd7 APN 3 51521405 missense probably damaging 1.00
IGL02806:Setd7 APN 3 51550267 missense probably damaging 0.97
IGL03258:Setd7 APN 3 51560515 splice site probably null
IGL03404:Setd7 APN 3 51532986 nonsense probably null
R0366:Setd7 UTSW 3 51550320 missense probably benign 0.07
R1328:Setd7 UTSW 3 51542819 missense possibly damaging 0.95
R1819:Setd7 UTSW 3 51542639 missense probably benign 0.38
R1872:Setd7 UTSW 3 51542831 missense probably benign 0.29
R2406:Setd7 UTSW 3 51542676 missense probably damaging 0.99
R2513:Setd7 UTSW 3 51533015 missense probably damaging 1.00
R4231:Setd7 UTSW 3 51542730 missense probably benign 0.24
R4627:Setd7 UTSW 3 51542665 missense probably damaging 0.99
R4687:Setd7 UTSW 3 51550355 missense probably damaging 1.00
R4770:Setd7 UTSW 3 51521422 missense probably damaging 1.00
R5212:Setd7 UTSW 3 51542817 missense probably damaging 1.00
R5472:Setd7 UTSW 3 51521465 missense probably benign 0.00
R6127:Setd7 UTSW 3 51530081 missense probably damaging 1.00
R6647:Setd7 UTSW 3 51542762 missense probably benign 0.00
R6966:Setd7 UTSW 3 51530184 missense probably damaging 1.00
R7828:Setd7 UTSW 3 51536657 critical splice acceptor site probably null
R7896:Setd7 UTSW 3 51536656 critical splice acceptor site probably null
R7979:Setd7 UTSW 3 51536656 critical splice acceptor site probably null
X0022:Setd7 UTSW 3 51542652 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- TCTCATGTCACGGCTGGAAG -3'
(R):5'- CTGCAAGCTTTGGTGAGGAAGG -3'

Sequencing Primer
(F):5'- CTGGAAGACAAGATGCTCAGATCTG -3'
(R):5'- GAAGGTTCTCTTCTAGCACGACTG -3'
Posted On2020-04-06