Incidental Mutation 'R7792:Pole'
ID628429
Institutional Source Beutler Lab
Gene Symbol Pole
Ensembl Gene ENSMUSG00000007080
Gene Namepolymerase (DNA directed), epsilon
Synonymspol-epsilon
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7792 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location110286306-110337474 bp(+) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) G to A at 110297466 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000007296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007296]
Predicted Effect probably null
Transcript: ENSMUST00000007296
SMART Domains Protein: ENSMUSP00000007296
Gene: ENSMUSG00000007080

DomainStartEndE-ValueType
POLBc 267 870 9.42e-97 SMART
Blast:POLBc 903 970 1e-28 BLAST
Blast:POLBc 1014 1073 2e-22 BLAST
Blast:POLBc 1195 1266 7e-21 BLAST
low complexity region 1275 1294 N/A INTRINSIC
Blast:DUF1744 1401 1430 2e-7 BLAST
DUF1744 1524 1924 1.9e-236 SMART
coiled coil region 1936 1963 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (97/97)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the catalytic subunit of DNA polymerase epsilon. The enzyme is involved in DNA repair and chromosomal DNA replication. Mutations in this gene have been associated with colorectal cancer 12 and facial dysmorphism, immunodeficiency, livedo, and short stature. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit increased incidence of tumors and premature death. Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E7. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik G A 18: 12,181,599 D289N probably damaging Het
Aars G T 8: 111,043,264 V332F possibly damaging Het
Abhd15 T A 11: 77,518,734 S425T probably benign Het
Acads A T 5: 115,112,781 F152L probably damaging Het
Acpp T A 9: 104,326,966 H43L probably damaging Het
Adora2a A G 10: 75,333,646 S315G probably benign Het
Agxt2 A T 15: 10,381,386 D242V probably damaging Het
Alx4 A G 2: 93,642,711 D18G probably damaging Het
Ankrd11 A G 8: 122,884,231 S2639P probably damaging Het
Arhgap35 A T 7: 16,561,528 V1204D possibly damaging Het
Arid2 A G 15: 96,369,375 T579A probably benign Het
B4galt1 C T 4: 40,809,373 G332S probably benign Het
B4galt4 C A 16: 38,757,810 Y206* probably null Het
Bcl2l14 A T 6: 134,432,314 T284S possibly damaging Het
Bop1 C T 15: 76,454,348 V465M probably damaging Het
Cacna1b A T 2: 24,677,965 L1037H probably damaging Het
Cadm2 G A 16: 66,771,637 T254M probably benign Het
Ccdc180 T C 4: 45,890,389 probably null Het
Ccdc7a A T 8: 128,892,437 D875E possibly damaging Het
Cenpu A G 8: 46,562,467 D139G possibly damaging Het
Cep57l1 A T 10: 41,722,940 C292* probably null Het
Cep89 G A 7: 35,429,928 R630H probably damaging Het
Chst14 A G 2: 118,927,775 H350R probably benign Het
Clca3a1 T A 3: 144,749,731 I434F possibly damaging Het
Crispld2 A G 8: 120,031,070 T385A probably benign Het
Crmp1 A C 5: 37,284,095 N507T probably damaging Het
Cyp4f40 T A 17: 32,671,169 I271N probably damaging Het
D630003M21Rik G T 2: 158,210,162 Q670K possibly damaging Het
Ddx42 T C 11: 106,236,996 I342T probably damaging Het
Dnah9 T A 11: 65,850,013 I4116F probably damaging Het
Ehd2 T C 7: 15,950,758 H372R probably benign Het
Gja8 C A 3: 96,919,776 C190F probably damaging Het
Gm13088 A G 4: 143,654,553 L300P probably benign Het
Gm8297 A T 14: 4,984,945 D72V possibly damaging Het
Golgb1 A G 16: 36,918,730 D2518G probably benign Het
Hsd17b12 C A 2: 94,033,641 M285I probably benign Het
Hus1 T C 11: 9,000,133 E196G probably damaging Het
Irf2 G A 8: 46,807,279 R82Q probably damaging Het
Irx2 A G 13: 72,631,374 D259G possibly damaging Het
Jph1 T A 1: 17,004,378 Q472L probably benign Het
Kif2a T C 13: 106,987,982 Q142R probably benign Het
Lonp1 T C 17: 56,622,515 Y174C probably damaging Het
Mapk14 T C 17: 28,746,297 F348L probably damaging Het
March10 G T 11: 105,390,228 D410E probably benign Het
Mff A T 1: 82,747,081 probably null Het
Necab3 G A 2: 154,546,280 R271C probably damaging Het
Nlrp4e T A 7: 23,321,757 F556L possibly damaging Het
Nt5c2 T C 19: 46,889,946 K425E probably benign Het
Ofcc1 A T 13: 40,142,826 W511R probably damaging Het
Olfr1283 T C 2: 111,369,403 I257T probably benign Het
Olfr347 A C 2: 36,734,330 E3A probably benign Het
Olfr551 T A 7: 102,588,883 probably benign Het
Olfr56 T A 11: 49,134,669 I159N possibly damaging Het
P2rx2 G C 5: 110,340,344 A448G possibly damaging Het
Papd5 A T 8: 88,252,554 Q561L probably benign Het
Pcnx2 A T 8: 125,892,018 N56K possibly damaging Het
Pdzd7 A C 19: 45,040,218 M162R possibly damaging Het
Phyhd1 A G 2: 30,266,770 M1V probably null Het
Pla2g16 T C 19: 7,579,295 C154R probably benign Het
Plekha5 A G 6: 140,589,224 E1126G possibly damaging Het
Plekhm1 A T 11: 103,397,060 V87D probably damaging Het
R3hcc1 T C 14: 69,705,508 M207V probably benign Het
R3hcc1l T A 19: 42,563,964 S467T probably damaging Het
Rasgrp4 G T 7: 29,143,102 R267L probably damaging Het
Rbm20 T C 19: 53,850,136 I848T probably benign Het
Rims2 T C 15: 39,198,528 S56P possibly damaging Het
Sacs T A 14: 61,209,773 D3089E probably benign Het
Sall2 C T 14: 52,316,064 G16R probably damaging Het
Scgb1b19 G A 7: 33,288,487 C93Y probably damaging Het
Scn3a T A 2: 65,466,990 K1442* probably null Het
Sepsecs A G 5: 52,644,049 S424P probably damaging Het
Set G T 2: 30,070,311 V219F probably benign Het
Sh3tc1 A T 5: 35,710,951 F390I probably damaging Het
Simc1 G A 13: 54,547,330 V1269M probably damaging Het
Ska3 T G 14: 57,810,055 D341A probably damaging Het
Skiv2l2 A T 13: 112,872,909 D985E probably benign Het
Slc16a10 A T 10: 40,037,415 probably null Het
Srgap1 T A 10: 121,925,967 N92I probably damaging Het
Sspo T C 6: 48,454,690 V639A probably damaging Het
Stk11 A T 10: 80,125,437 probably benign Het
Sult5a1 G A 8: 123,145,441 H221Y probably benign Het
Sytl3 T A 17: 6,736,578 M559K probably benign Het
Tab2 A C 10: 7,919,133 D528E possibly damaging Het
Tbc1d15 A G 10: 115,221,587 I218T possibly damaging Het
Tenm4 T A 7: 96,774,014 M672K possibly damaging Het
Tfrc A G 16: 32,619,167 K346R probably benign Het
Thsd1 G T 8: 22,243,098 G54W probably damaging Het
Tmprss15 A T 16: 79,003,387 L618I probably damaging Het
Top3a T C 11: 60,742,964 S769G probably benign Het
Trp63 C A 16: 25,868,224 P396Q possibly damaging Het
Ttc30a2 T C 2: 75,976,929 N413S probably benign Het
Uggt1 T C 1: 36,207,984 S311G probably damaging Het
Usp10 G A 8: 119,952,001 E574K possibly damaging Het
Wfdc6b T A 2: 164,617,902 I148K probably damaging Het
Zcchc2 T G 1: 106,018,252 I474R probably damaging Het
Zdhhc2 A G 8: 40,447,141 K82R probably benign Het
Zfp273 A G 13: 67,826,016 D421G possibly damaging Het
Zfp280d T C 9: 72,331,319 I639T probably damaging Het
Zfp429 A T 13: 67,390,439 C295* probably null Het
Other mutations in Pole
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Pole APN 5 110303565 splice site probably benign
IGL00475:Pole APN 5 110291096 nonsense probably null
IGL00837:Pole APN 5 110302009 missense possibly damaging 0.91
IGL00976:Pole APN 5 110323572 missense probably benign 0.00
IGL01081:Pole APN 5 110337240 missense possibly damaging 0.92
IGL01503:Pole APN 5 110303884 missense probably damaging 1.00
IGL01640:Pole APN 5 110298266 missense probably null 0.08
IGL01987:Pole APN 5 110337232 missense probably benign 0.01
IGL02429:Pole APN 5 110299800 missense probably benign
IGL02733:Pole APN 5 110312728 splice site probably benign
IGL03102:Pole APN 5 110297073 missense probably damaging 1.00
IGL03157:Pole APN 5 110293753 missense probably benign
IGL03186:Pole APN 5 110299920 critical splice donor site probably null
IGL03271:Pole APN 5 110318319 missense probably benign
IGL03351:Pole APN 5 110301998 splice site probably benign
IGL03408:Pole APN 5 110294560 missense probably damaging 1.00
IGL03410:Pole APN 5 110324559 missense probably benign
ANU74:Pole UTSW 5 110289370 missense probably benign 0.44
PIT4495001:Pole UTSW 5 110303914 missense probably damaging 1.00
R0053:Pole UTSW 5 110293340 missense probably damaging 1.00
R0053:Pole UTSW 5 110293340 missense probably damaging 1.00
R0124:Pole UTSW 5 110303992 missense probably damaging 0.96
R0145:Pole UTSW 5 110324425 missense probably damaging 0.99
R0523:Pole UTSW 5 110303593 missense probably damaging 0.96
R0590:Pole UTSW 5 110317926 missense probably benign
R0625:Pole UTSW 5 110325550 missense possibly damaging 0.50
R0707:Pole UTSW 5 110298988 missense probably damaging 1.00
R1160:Pole UTSW 5 110295253 missense possibly damaging 0.85
R1320:Pole UTSW 5 110309129 frame shift probably null
R1384:Pole UTSW 5 110323664 missense possibly damaging 0.81
R1626:Pole UTSW 5 110293369 missense probably benign 0.25
R1643:Pole UTSW 5 110317845 missense probably damaging 1.00
R1655:Pole UTSW 5 110335922 missense probably damaging 1.00
R1668:Pole UTSW 5 110297369 missense probably damaging 1.00
R1783:Pole UTSW 5 110297430 missense probably damaging 1.00
R1843:Pole UTSW 5 110330835 critical splice donor site probably null
R1853:Pole UTSW 5 110306853 missense possibly damaging 0.95
R1867:Pole UTSW 5 110334197 missense probably benign 0.08
R1874:Pole UTSW 5 110323664 missense possibly damaging 0.81
R1891:Pole UTSW 5 110332542 missense probably damaging 1.00
R1928:Pole UTSW 5 110327778 missense probably benign
R2073:Pole UTSW 5 110325551 missense probably damaging 0.99
R2341:Pole UTSW 5 110330963 missense possibly damaging 0.67
R2448:Pole UTSW 5 110297092 missense probably damaging 1.00
R2504:Pole UTSW 5 110290502 splice site probably null
R3053:Pole UTSW 5 110289795 missense probably damaging 1.00
R3892:Pole UTSW 5 110336439 missense probably damaging 1.00
R3964:Pole UTSW 5 110312782 missense probably damaging 1.00
R3965:Pole UTSW 5 110312782 missense probably damaging 1.00
R4374:Pole UTSW 5 110337205 missense possibly damaging 0.89
R4376:Pole UTSW 5 110337205 missense possibly damaging 0.89
R4377:Pole UTSW 5 110337205 missense possibly damaging 0.89
R4520:Pole UTSW 5 110297924 missense probably damaging 1.00
R4670:Pole UTSW 5 110306387 missense probably benign 0.01
R4778:Pole UTSW 5 110330832 missense probably benign 0.00
R4887:Pole UTSW 5 110324753 missense probably damaging 0.99
R4898:Pole UTSW 5 110290224 critical splice acceptor site probably null
R5184:Pole UTSW 5 110294934 missense possibly damaging 0.91
R5359:Pole UTSW 5 110332488 missense probably benign 0.03
R5483:Pole UTSW 5 110294568 missense probably damaging 1.00
R5529:Pole UTSW 5 110332466 missense probably benign 0.20
R5576:Pole UTSW 5 110312065 nonsense probably null
R5817:Pole UTSW 5 110312972 missense probably damaging 1.00
R5877:Pole UTSW 5 110332463 missense probably benign
R5956:Pole UTSW 5 110337287 unclassified probably benign
R5990:Pole UTSW 5 110302144 missense probably damaging 1.00
R6019:Pole UTSW 5 110324514 missense probably benign 0.01
R6019:Pole UTSW 5 110324515 missense probably benign 0.01
R6093:Pole UTSW 5 110312090 missense probably benign 0.01
R6376:Pole UTSW 5 110336374 missense probably damaging 0.99
R6494:Pole UTSW 5 110324722 missense possibly damaging 0.86
R6535:Pole UTSW 5 110324807 missense probably damaging 1.00
R6723:Pole UTSW 5 110323616 missense probably benign 0.11
R6757:Pole UTSW 5 110303610 missense probably damaging 1.00
R6930:Pole UTSW 5 110293290 missense probably benign 0.01
R6988:Pole UTSW 5 110329583 missense probably damaging 0.97
R6992:Pole UTSW 5 110332499 missense probably damaging 0.99
R7067:Pole UTSW 5 110334218 missense probably damaging 1.00
R7097:Pole UTSW 5 110325102 synonymous probably null
R7122:Pole UTSW 5 110325102 synonymous probably null
R7202:Pole UTSW 5 110297107 missense possibly damaging 0.94
R7340:Pole UTSW 5 110334464 missense probably benign 0.06
R7345:Pole UTSW 5 110303903 missense possibly damaging 0.82
R7509:Pole UTSW 5 110330705 start gained probably benign
R7557:Pole UTSW 5 110312994 missense probably damaging 1.00
R7740:Pole UTSW 5 110331041 missense probably benign 0.00
R7832:Pole UTSW 5 110317797 missense probably benign 0.00
R7849:Pole UTSW 5 110332548 missense probably benign 0.04
R7852:Pole UTSW 5 110306829 missense probably damaging 1.00
R7915:Pole UTSW 5 110317797 missense probably benign 0.00
R7932:Pole UTSW 5 110332548 missense probably benign 0.04
R7935:Pole UTSW 5 110306829 missense probably damaging 1.00
R8001:Pole UTSW 5 110312734 missense probably damaging 1.00
X0064:Pole UTSW 5 110317904 nonsense probably null
Y5377:Pole UTSW 5 110294891 critical splice acceptor site probably null
Y5380:Pole UTSW 5 110294891 critical splice acceptor site probably null
Z1088:Pole UTSW 5 110327865 missense possibly damaging 0.66
Z1177:Pole UTSW 5 110297009 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGTGTACTCCTGCTCAGCC -3'
(R):5'- ATCTAACCTTGACTGTAACGTGG -3'

Sequencing Primer
(F):5'- TATTTCATGAATTTCCTTGGACCC -3'
(R):5'- CCTTGACTGTAACGTGGAAGGAAAG -3'
Posted On2020-04-06