Mutagenetix > Incidental Mutation

Incidental Mutation 'R0715:Fzd8'

62843

Institutional Source

Beutler Lab

Gene Symbol

Fzd8

Ensembl Gene

ENSMUSG00000036904

Gene Name

frizzled class receptor 8

Synonyms

mFZ8, Fz8

MMRRC Submission

038898-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0715 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

9212856-9216201 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 9212947 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 10 (T10A)

Ref Sequence

ENSEMBL: ENSMUSP00000039660 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041080]

AlphaFold

Q61091

PDB Structure

CRYSTAL STRUCTURE OF THE CYSTEINE-RICH DOMAIN OF MOUSE FRIZZLED 8 (MFZ8) [X-RAY DIFFRACTION]
Crystal structure of XWnt8 in complex with the cysteine-rich domain of Frizzled 8 [X-RAY DIFFRACTION]

Predicted Effect

unknown
Transcript: ENSMUST00000041080
AA Change: T10A

SMART Domains

Protein: ENSMUSP00000039660
Gene: ENSMUSG00000036904
AA Change: T10A

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
FRI	34	153	9.06e-73	SMART
low complexity region	161	228	N/A	INTRINSIC
Frizzled	264	621	1.47e-219	SMART
low complexity region	624	655	N/A	INTRINSIC

Meta Mutation Damage Score

0.0593

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.6%
20x: 95.8%

Validation Efficiency

98% (61/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This intronless gene is a member of the frizzled gene family. Members of this family encode seven-transmembrane domain proteins that are receptors for the Wingless type MMTV integration site family of signaling proteins. Most frizzled receptors are coupled to the beta-catenin canonical signaling pathway. This gene is highly expressed in two human cancer cell lines, indicating that it may play a role in several types of cancer. The crystal structure of the extracellular cysteine-rich domain of a similar mouse protein has been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene does not appear to result in a phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	T	A	15: 8,223,092	C1933S	probably benign	Het
4930438A08Rik	A	G	11: 58,288,350	Y170C	probably damaging	Het
Adcy2	C	T	13: 68,888,042	V167I	probably benign	Het
Agl	A	G	3: 116,752,176	Y1324H	probably damaging	Het
Arhgef37	G	T	18: 61,508,789	Q170K	probably damaging	Het
Asah2	A	G	19: 32,016,776	S390P	probably damaging	Het
Atp8a1	A	T	5: 67,774,725	H240Q	probably benign	Het
Btbd16	T	A	7: 130,788,827	N151K	probably damaging	Het
Ccdc73	T	A	2: 104,973,154		probably benign	Het
Cecr2	G	T	6: 120,758,198	M21I	probably benign	Het
Ckap2l	T	C	2: 129,285,716	T181A	probably benign	Het
Col4a3	T	C	1: 82,652,158		probably benign	Het
Dnah9	A	G	11: 66,081,248		probably benign	Het
Fat3	T	C	9: 16,375,123	T1035A	probably benign	Het
Gm11639	T	C	11: 104,720,880	L516P	possibly damaging	Het
Gm9631	C	A	11: 121,942,502	C636F	probably damaging	Het
Gp1ba	A	G	11: 70,640,788		probably benign	Het
Gsk3a	A	G	7: 25,231,709	V277A	probably damaging	Het
H2-M1	T	A	17: 36,670,228		probably benign	Het
Hesx1	T	A	14: 27,000,852	W45R	probably damaging	Het
Il23r	T	A	6: 67,486,333	M59L	possibly damaging	Het
Insc	T	A	7: 114,845,077	V433E	probably benign	Het
Itga8	T	C	2: 12,191,242		probably benign	Het
Kif13a	T	A	13: 46,812,823	E436V	probably damaging	Het
Liph	A	G	16: 21,995,350	F7S	probably benign	Het
Lpar2	T	C	8: 69,824,173	V204A	probably damaging	Het
Lrfn4	T	A	19: 4,612,640		probably null	Het
Man2b2	A	T	5: 36,826,058	D182E	probably benign	Het
Mmp27	T	C	9: 7,581,155		probably benign	Het
Mrm1	A	G	11: 84,814,813		probably benign	Het
Mtx3	T	C	13: 92,850,361	S271P	probably damaging	Het
Myh11	A	T	16: 14,226,616	M641K	possibly damaging	Het
Necab2	A	G	8: 119,470,931	D332G	probably damaging	Het
Ngfr	A	G	11: 95,574,239	I261T	possibly damaging	Het
Nrap	T	C	19: 56,357,325	E617G	probably damaging	Het
Obscn	G	T	11: 59,050,480	T4505K	probably benign	Het
Olfr884	G	T	9: 38,047,827	V202L	probably benign	Het
Olfr983	A	G	9: 40,092,511	Y148H	probably damaging	Het
Osbpl11	T	A	16: 33,241,730		probably benign	Het
Otof	A	G	5: 30,394,697	V301A	probably damaging	Het
Phf3	A	T	1: 30,811,838	L1145Q	probably damaging	Het
Phospho2	T	A	2: 69,796,196	I232N	possibly damaging	Het
Pomgnt2	T	A	9: 121,982,061	K551N	probably damaging	Het
Ptchd3	A	G	11: 121,831,158	T286A	possibly damaging	Het
Rnf213	A	G	11: 119,441,150	D2396G	probably damaging	Het
Sh3pxd2b	A	G	11: 32,423,341	E836G	possibly damaging	Het
Simc1	G	T	13: 54,525,655	M605I	possibly damaging	Het
Slc12a3	G	A	8: 94,329,433	E66K	possibly damaging	Het
Spg11	T	C	2: 122,084,983	N1060S	probably benign	Het
Supt5	A	T	7: 28,329,037	W178R	probably damaging	Het
Tmem41a	G	T	16: 21,937,990	F126L	probably benign	Het
Ube2m	T	A	7: 13,037,626	Q35L	probably benign	Het
Usp33	A	G	3: 152,380,574	D658G	probably damaging	Het
Vmn2r12	A	T	5: 109,090,507	C456S	probably benign	Het
Vmn2r81	T	A	10: 79,268,600	D352E	probably damaging	Het
Zfp516	A	G	18: 82,987,263	Y764C	probably damaging	Het
Zswim7	A	G	11: 62,276,647		probably benign	Het

Other mutations in Fzd8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00571:Fzd8	APN	18	9213068	missense	unknown
IGL01511:Fzd8	APN	18	9213293	missense	unknown
IGL03129:Fzd8	APN	18	9214270	missense	probably damaging	1.00
Stilt	UTSW	18	9213880	missense	probably damaging	1.00
R0058:Fzd8	UTSW	18	9213985	missense	possibly damaging	0.92
R0966:Fzd8	UTSW	18	9214745	missense	probably damaging	0.99
R1717:Fzd8	UTSW	18	9214364	missense	probably damaging	1.00
R1751:Fzd8	UTSW	18	9213643	missense	probably damaging	0.98
R1761:Fzd8	UTSW	18	9213643	missense	probably damaging	0.98
R1905:Fzd8	UTSW	18	9213803	missense	probably damaging	1.00
R1956:Fzd8	UTSW	18	9214502	missense	probably damaging	1.00
R2892:Fzd8	UTSW	18	9214514	missense	probably damaging	1.00
R3897:Fzd8	UTSW	18	9214939	missense	possibly damaging	0.89
R3968:Fzd8	UTSW	18	9214070	missense	probably damaging	0.98
R4934:Fzd8	UTSW	18	9214492	frame shift	probably null
R5366:Fzd8	UTSW	18	9213880	missense	probably damaging	1.00
R5624:Fzd8	UTSW	18	9213268	missense	unknown
R6261:Fzd8	UTSW	18	9214598	missense	possibly damaging	0.61
R6757:Fzd8	UTSW	18	9213238	missense	possibly damaging	0.78
R6758:Fzd8	UTSW	18	9213238	missense	possibly damaging	0.78
R6899:Fzd8	UTSW	18	9214729	missense	probably damaging	0.98
R7242:Fzd8	UTSW	18	9214171	missense	probably damaging	1.00
R8140:Fzd8	UTSW	18	9213797	missense	probably damaging	1.00
R8324:Fzd8	UTSW	18	9214688	missense	probably damaging	1.00
R8722:Fzd8	UTSW	18	9213686	missense	possibly damaging	0.67
R8818:Fzd8	UTSW	18	9214474	missense	probably benign	0.26
R8820:Fzd8	UTSW	18	9213247	missense	unknown
R8913:Fzd8	UTSW	18	9213869	missense	probably damaging	1.00
R9036:Fzd8	UTSW	18	9214661	missense	probably damaging	1.00
R9401:Fzd8	UTSW	18	9213205	missense	possibly damaging	0.78

Predicted Primers

PCR Primer
(F):5'- CCTGCTGCCTGAAAAGGAGATAGAC -3'
(R):5'- GTTGTAGTCCATGCACAGAGTGTCC -3'

Sequencing Primer
(F):5'- GGAGATAGACTGTTGCTATTCTCCTC -3'
(R):5'- CTTGTAGTCCTCCAGGCAGATG -3'

Posted On

2013-07-30