Incidental Mutation 'RF005:Cyp4f16'
ID 628434
Institutional Source Beutler Lab
Gene Symbol Cyp4f16
Ensembl Gene ENSMUSG00000048440
Gene Name cytochrome P450, family 4, subfamily f, polypeptide 16
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # RF005 (G1)
Quality Score 224.009
Status Validated
Chromosome 17
Chromosomal Location 32536558-32551798 bp(+) (GRCm38)
Type of Mutation splice site (42 bp from exon)
DNA Base Change (assembly) C to A at 32545195 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000131058 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003416] [ENSMUST00000165515] [ENSMUST00000169252] [ENSMUST00000169591]
AlphaFold Q99N17
Predicted Effect probably null
Transcript: ENSMUST00000003416
SMART Domains Protein: ENSMUSP00000003416
Gene: ENSMUSG00000048440

Pfam:p450 52 515 4.7e-133 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165515
SMART Domains Protein: ENSMUSP00000126845
Gene: ENSMUSG00000048440

transmembrane domain 15 37 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169252
SMART Domains Protein: ENSMUSP00000128349
Gene: ENSMUSG00000048440

signal peptide 1 36 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000169591
SMART Domains Protein: ENSMUSP00000131058
Gene: ENSMUSG00000048440

Pfam:p450 52 515 4.7e-133 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.6%
Validation Efficiency 94% (65/69)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005L19Rik CTGCTG CTGCTGTGGATGCTG 1: 82,913,585 probably benign Het
Abca1 G T 4: 53,049,125 T1651N probably damaging Het
Adamtsl3 A G 7: 82,612,395 T40A Het
Adgra3 A T 5: 50,013,387 probably null Het
Apcs A T 1: 172,894,242 M179K probably damaging Het
Baiap2 G A 11: 119,996,529 E217K possibly damaging Het
Ccdc69 A G 11: 55,060,523 L24P probably damaging Het
Cdh16 T G 8: 104,617,052 N604T probably damaging Het
Cfb C T 17: 34,858,046 V538I possibly damaging Het
Col6a3 A G 1: 90,811,262 S1022P probably benign Het
Cpeb1 A G 7: 81,361,806 L129S possibly damaging Het
Crybg1 A G 10: 44,004,745 V149A probably benign Het
Dlg5 G A 14: 24,158,493 Q882* probably null Het
Fsip2 T A 2: 82,992,532 I6203K probably benign Het
Gabre CCGGCT CCGGCTACGGCT X: 72,270,045 probably null Het
Gm17660 A C 5: 104,074,859 probably null Het
Gm9513 T C 9: 36,475,674 S13P possibly damaging Het
Gprc5d A T 6: 135,116,519 L130Q probably damaging Het
H13 G A 2: 152,669,669 E30K probably damaging Het
Hmcn1 T A 1: 150,635,146 K3609* probably null Het
Hsdl2 GCTGCAG GCTGCAGCAGCAGCCACATCTGCAG 4: 59,610,652 probably benign Het
Kl A C 5: 150,953,420 Y235S probably benign Het
Map6d1 G A 16: 20,241,000 T105I probably benign Het
Mast4 GGTGGTGGTGG GGTGGTGGTGGTGGTGG 13: 102,736,307 probably benign Het
Mms22l A G 4: 24,517,207 I363V probably benign Het
Myo7a T C 7: 98,093,617 I391V probably benign Het
Nab2 A T 10: 127,664,364 D286E probably benign Het
Nrxn1 G A 17: 90,362,876 R1144C probably damaging Het
Olfr1039 T C 2: 86,131,070 M198V probably benign Het
Olfr592 T C 7: 103,186,691 I30T possibly damaging Het
Olfr635 A G 7: 103,979,561 D123G probably damaging Het
Pan2 G A 10: 128,315,535 E842K probably benign Het
Prex2 A C 1: 11,185,166 D1145A possibly damaging Het
Prop1 A C 11: 50,951,130 Y150D possibly damaging Het
Psip1 T C 4: 83,460,498 I353M probably damaging Het
Rapgef1 C A 2: 29,707,195 probably null Het
Rgl1 G A 1: 152,521,363 S684L probably benign Het
Sbf2 T A 7: 110,317,008 D1552V probably damaging Het
Serpinh1 C T 7: 99,346,203 V391M probably damaging Het
Slc35e4 A T 11: 3,907,960 L215Q possibly damaging Het
Tbl3 TCTT TCTTCTT 17: 24,702,541 probably benign Het
Tex15 T A 8: 33,576,677 M2045K probably benign Het
Tmprss15 T C 16: 78,953,801 *1070W probably null Het
Trav15-2-dv6-2 GGGAG GGGAGGAG 14: 53,649,750 probably benign Het
Trav15-2-dv6-2 GGAG GGAGGAG 14: 53,649,751 probably benign Het
Trav15-2-dv6-2 GAA GAACAA 14: 53,649,754 probably benign Het
Trim33 GCCCCGGCCCCCG GCCCCG 3: 103,280,212 probably null Het
Tub C A 7: 109,022,639 Q95K probably benign Het
Uhrf1bp1 A T 17: 27,885,531 D517V probably damaging Het
Usp9y T A Y: 1,435,046 Q261L probably benign Het
Utp20 A T 10: 88,825,457 D29E probably damaging Het
Vill G A 9: 119,060,439 V148M probably damaging Het
Vmn2r120 C T 17: 57,521,991 E535K possibly damaging Het
Zfp451 A T 1: 33,776,792 Y692* probably null Het
Zfp599 A C 9: 22,253,884 V65G probably benign Het
Zfp808 T C 13: 62,171,299 V114A probably benign Het
Other mutations in Cyp4f16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02941:Cyp4f16 APN 17 32537087 missense possibly damaging 0.75
IGL03400:Cyp4f16 APN 17 32550353 missense probably benign 0.00
R0437:Cyp4f16 UTSW 17 32537098 missense possibly damaging 0.46
R0454:Cyp4f16 UTSW 17 32537087 missense probably damaging 0.97
R0482:Cyp4f16 UTSW 17 32550551 missense probably damaging 1.00
R1422:Cyp4f16 UTSW 17 32542999 missense probably damaging 0.99
R1435:Cyp4f16 UTSW 17 32550734 nonsense probably null
R1440:Cyp4f16 UTSW 17 32550734 nonsense probably null
R1616:Cyp4f16 UTSW 17 32542968 nonsense probably null
R1840:Cyp4f16 UTSW 17 32543006 critical splice donor site probably null
R1854:Cyp4f16 UTSW 17 32537099 missense probably damaging 0.99
R1912:Cyp4f16 UTSW 17 32545044 missense probably damaging 0.99
R2200:Cyp4f16 UTSW 17 32537104 missense probably damaging 0.98
R3803:Cyp4f16 UTSW 17 32544884 missense possibly damaging 0.96
R4811:Cyp4f16 UTSW 17 32545106 missense probably benign
R4812:Cyp4f16 UTSW 17 32546678 missense probably null 1.00
R4837:Cyp4f16 UTSW 17 32542764 missense possibly damaging 0.59
R4867:Cyp4f16 UTSW 17 32550750 missense possibly damaging 0.94
R4909:Cyp4f16 UTSW 17 32550321 missense possibly damaging 0.46
R5857:Cyp4f16 UTSW 17 32537024 missense probably damaging 1.00
R5986:Cyp4f16 UTSW 17 32544142 missense probably benign 0.45
R6013:Cyp4f16 UTSW 17 32546678 missense probably null 1.00
R6408:Cyp4f16 UTSW 17 32551199 missense probably damaging 1.00
R6651:Cyp4f16 UTSW 17 32544144 missense probably benign 0.00
R7463:Cyp4f16 UTSW 17 32550787 missense possibly damaging 0.89
R7923:Cyp4f16 UTSW 17 32546747 missense possibly damaging 0.67
X0017:Cyp4f16 UTSW 17 32544936 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2020-04-07